Journal of Jilin University(Medicine Edition) ›› 2025, Vol. 51 ›› Issue (6): 1452-1463.doi: 10.13481/j.1671-587X.20250602
• Research in basic medicine • Previous Articles Next Articles
Xiaoqian TANG,Shengcong WEN,Zhenya DONG,Jingyi CHEN,Yu CAO,Yunhua ZHANG(
)
Received:2024-11-07
Accepted:2025-02-12
Online:2025-11-28
Published:2025-12-15
Contact:
Yunhua ZHANG
E-mail:yunhuazhang@shzu.edu.cn
CLC Number:
Xiaoqian TANG,Shengcong WEN,Zhenya DONG,Jingyi CHEN,Yu CAO,Yunhua ZHANG. Improvement effect of engineered exosomes delivering ANGPTL6 mRNA on liver fibrosis in mice[J].Journal of Jilin University(Medicine Edition), 2025, 51(6): 1452-1463.
Tab.1
Primer sequences of RT-qPCR"
| Primer | Sequences (5'-3') | NCBI Refseq |
|---|---|---|
| ANGPTL6 | Forward: CTGGGCCGTCGTGTAGTAG | NM_145154.2 |
| Reverse: CAGTCCTCTAGGAGTATCAGCAG | ||
| α-SMA | Forward: GTCCCAGACATCAGGGAGTAA | NM_007392.3 |
| Reverse: TCGGATACTTCAGCGTCAGGA | ||
| Col1a1 | Forward: GCTCCTCTTAGGGGCCACT | NM_007742.4 |
| Reverse: CCACGTCTCACCATTGGGG | ||
| TGF-β1 | Forward: CTCCCGTGGCTTCTAGTGC | NM_011577.2 |
| Reverse: GCCTTAGTTTGGACAGGATCTG | ||
| TIMP-1 | Forward: GCAACTCGGACCTGGTCATAA | NM_001044384.2 |
| Reverse: CGGCCCGTGATGAGAAACT | ||
| β-actin | Forward: GGCTGTATTCCCCTCCATCG | NM_007393.5 |
| Reverse: CCAGTTGGTAACAATGCCATGT |
| [1] | ROEHLEN N, CROUCHET E, BAUMERT T F. Liver fibrosis: mechanistic concepts and therapeutic perspectives[J]. Cells, 2020, 9(4): 875. |
| [2] | PAROLA M, PINZANI M. Liver fibrosis: Pathophysiology, pathogenetic targets and clinical issues[J]. Mol Aspects Med, 2019, 65: 37-55. |
| [3] | WANG Y K, WANG M Q, LIU C R, et al. Global burden of liver cirrhosis 1990-2019 and 20 years forecast: results from the global burden of disease study 2019[J]. Ann Med, 2024, 56(1): 2328521. |
| [4] | MOHAMMED O S, ATTIA H G, MOHAMED B M S A, et al. Current investigations for liver fibrosis treatment: between repurposing the FDA-approved drugs and the other emerging approaches[J]. J Pharm Pharm Sci, 2023, 26: 11808. |
| [5] | ZHANG C Y, LIU S, YANG M. Treatment of liver fibrosis: Past, current, and future[J]. World J Hepatol, 2023, 15(6): 755-774. |
| [6] | OIKE Y, YASUNAGA K, ITO Y, et al. Angiopoietin-related growth factor (AGF) promotes epidermal proliferation, remodeling, and regeneration[J]. Proc Natl Acad Sci U S A, 2003, 100(16): 9494-9499. |
| [7] | OIKE Y, AKAO M, YASUNAGA K, et al. Angiopoietin-related growth factor antagonizes obesity and insulin resistance[J]. Nat Med, 2005, 11(4): 400-408. |
| [8] | HOSTETTLER I C, O’CALLAGHAN B, BUGIARDINI E, et al. ANGPTL6 genetic variants are an underlying cause of familial intracranial aneurysms[J]. Neurology, 2021, 96(6): e947-e955. |
| [9] | WANG Z H, TANG M Z, RONG Y, et al. ANGPTL6 can be used as potential biomarkers for the diagnosis and prognosis of thyroid cancer[J]. Asian J Surg, 2024, 47(7): 3079-3081. |
| [10] | QADDOUMI M G, ALANBAEI M, HAMMAD M M, et al. Investigating the role of myeloperoxidase and angiopoietin-like protein 6 in obesity and diabetes[J]. Sci Rep, 2020, 10(1): 6170. |
| [11] | ABELS E R, BREAKEFIELD X O. Introduction to extracellular vesicles: biogenesis, RNA cargo selection, content, release, and uptake[J]. Cell Mol Neurobiol, 2016, 36(3): 301-312. |
| [12] | RAFIEEZADEH D. Extracellular vesicles and their therapeutic applications: a review article (part 2)[J]. Int J Physiol Pathophysiol Pharmacol, 2024, 16(4): 81-88. |
| [13] | FAN W G, LIU T H, CHEN W, et al. ECM1 prevents activation of transforming growth factor β, hepatic stellate cells, and fibrogenesis in mice[J]. Gastroenterology, 2019, 157(5): 1352-1367.e13. |
| [14] | HORN P, TACKE F. Metabolic reprogramming in liver fibrosis[J]. Cell Metab, 2024, 36(7): 1439-1455. |
| [15] | KAMM D R, MCCOMMIS K S. Hepatic stellate cells in physiology and pathology[J]. J Physiol, 2022, 600(8): 1825-1837. |
| [16] | ZHANG M F, SERNA-SALAS S, DAMBA T, et al. Hepatic stellate cell senescence in liver fibrosis: Characteristics, mechanisms and perspectives[J]. Mech Ageing Dev, 2021, 199: 111572. |
| [17] | KONG M, ZHOU J J, KANG A Q, et al. Histone methyltransferase Suv39h1 regulates hepatic stellate cell activation and is targetable in liver fibrosis[J]. Gut, 2024, 73(5): 810-824. |
| [18] | DING J, XU C, XU M, et al. Emerging role of engineered exosomes in nonalcoholic fatty liver disease[J]. World J Hepatol, 2023, 15(3): 386-392. |
| [19] | KOJIMA R, BOJAR D, RIZZI G, et al. Designer exosomes produced by implanted cells intracerebrally deliver therapeutic cargo for Parkinson’s disease treatment[J]. Nat Commun, 2018, 9(1): 1305. |
| [20] | SAITO H, KOBAYASHI T, HARA T, et al. Synthetic translational regulation by an L7Ae-kink-turn RNP switch[J]. Nat Chem Biol, 2010, 6(1): 71-78. |
| [21] | LIANG Y J, DUAN L, LU J P, et al. Engineering exosomes for targeted drug delivery[J]. Theranostics, 2021, 11(7): 3183-3195. |
| [22] | URABE F, KOSAKA N, ITO K, et al. Extracellular vesicles as biomarkers and therapeutic targets for cancer[J]. Am J Physiol Cell Physiol, 2020, 318(1): C29-C39. |
| [23] | AMERNIA B, MOOSAVY S H, BANOOKH F, et al. FIB-4, APRI, and AST/ALT ratio compared to FibroScan for the assessment of hepatic fibrosis in patients with non-alcoholic fatty liver disease in Bandar Abbas, Iran[J]. BMC Gastroenterol, 2021, 21(1): 453. |
| [24] | DUAN B W, LIU Y J, LI X N, et al. An autologous macrophage-based phenotypic transformation-collagen degradation system treating advanced liver fibrosis[J]. Adv Sci, 2024, 11(7): 2306899. |
| [25] | XUE X Y, ZHAO X T, WANG J, et al. Carthami flos extract against carbon tetrachloride-induced liver fibrosis via alleviating angiogenesis in mice[J]. Phytomedicine, 2023, 108: 154517. |
| [26] | XU S X, CHEN Y E, MIAO J D, et al. Esculin inhibits hepatic stellate cell activation and CCl(4)-induced liver fibrosis by activating the Nrf2/GPX4 signaling pathway[J]. Phytomedicine, 2024, 128: 155465. |
| [27] | WANG C, ZHANG S L, LI Y Z, et al. Phillygenin inhibits TGF-β1-induced hepatic stellate cell activation and inflammation: regulation of the bax/bcl-2 and Wnt/β-catenin pathways[J]. Inflammation, 2024, 47(4): 1403-1422. |
| [28] | MEDEIROS T, SARAIVA G N, MORAES L A, et al. Liver fibrosis improvement in chronic hepatitis C after direct acting-antivirals is accompanied by reduced profibrogenic biomarkers-a role for MMP-9/TIMP-1[J]. Dig Liver Dis, 2020, 52(10): 1170-1177. |
| [29] | JI Y, DUAN Y L, LI Y Y, et al. A long-acting FGF21 attenuates metabolic dysfunction-associated steatohepatitis-related fibrosis by modulating NR4A1-mediated Ly6C phenotypic switch in macrophages[J]. Br J Pharmacol, 2024, 181(16): 2923-2946. |
| [30] | YANG J, CHEN L, ZHAO S S, et al. FGF21-dependent alleviation of cholestasis-induced liver fibrosis by sodium butyrate[J]. Front Pharmacol, 2024, 15: 1422770. |
| [31] | KANG S G, YI H S, CHOI M J, et al. ANGPTL6 expression is coupled with mitochondrial OXPHOS function to regulate adipose FGF21[J]. J Endocrinol, 2017, 233(1): 105-118. |
| [1] | Shu LI,Jiaqi GUO,Wansong LI,Yanfeng ZHEN,Hongjia ZHAI,Jie LI,Hui FANG. Improvement effect of fingolimod on hepatic fibrosis in type 2 diabetes mellitus mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 330-339. |
| [2] | Huiyuan YU,Ling JIN,Ying YU,Xue WANG,Bing WANG. Improvement effect of epicatechin on liver injury in mice induced by acetaminophen and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1498-1507. |
| [3] | Yi ZHAO,Bing ZHOU,Huirui QIU,Xuan LI,Xiangli CUI. Improvement effect of lovastatin on hyperlipidemia-induced liver injury in rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1155-1164. |
| [4] | Huixian XU,Hui XU,Jishu QUAN,Feng ZHENG. Inhibitory effect of iridoid glycosides from Boschniakia rossica on hepatic preneolasia of rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 887-895. |
| [5] | Kaiqi NIU,He CHANG,Guangfu LYU,Pengyu ZHENG,Xueting CHI,Jia ZHOU,Yuchen WANG,Xiaowei HUANG. Inhibitory effect of astragaloside Ⅳ on cisplatin-induced liver injury in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 370-377. |
| [6] | Chaohe ZHANG,Xinwei ZHANG,Xiangfeng WANG. Protective effect of Pien-Tze-Huang on acetaminophen-induced liver injury and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(1): 105-114. |
| [7] | Yi LONG,Ziyi YOU,Xiuying TAN,Rou ZHANG,Yuhan ZHANG,Lina YANG. Protective effect of sodium butyrate on acute liver injury in mice induced by lipopolysaccharide combined with D-galactosamine and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1614-1620. |
| [8] | Jing GUAN,Shen HA,Hao YUAN,Ying CHEN,Pengju LIU,Zhi LIU,Shuang JIANG. Protective effect of Modified Xiao-Xian-Xiong Decoction on liver injury in rats with type 2 diabete mellitus and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 608-616. |
| [9] | Lingyao XU,Shutang WEI,Yong DONG,Zhenglu SUN,Junbo ZHAO,Dazheng HAN. Regulatory effect of lncRNA MALAT1 on activation of hepatic stellate cell and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 697-705. |
| [10] | Mingliu GU,Fengyuan LIN,Xuefeng WU,Jianing ZHOU,Xuechun LU,Peige DU,Liping AN. Improvement effect of Phellinus igniarius acidic polysaccharide on liver fibrosis induced by bile duct ligation in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(5): 1167-1174. |
| [11] | Yang ZHENG,Jiahui WANG,Yue PENG,Xianling YUAN,Lei WANG,Tiejian ZHAO. Influence of curcumol in structure of liver sinusoidal endothelial cells of mice and its inhibitiory effect on intrahepatic angiogenesis [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1124-1130. |
| [12] | Zhouguang WU,Bin WANG,Zhen CHENG,Wenjie ZHANG,Taoyan ZUO,Siqi CHEN,Jingru FU. Analysis on correlation of GPC3 and α-SMA expressions with liver function-related indexes in liver tissue of children with biliary atresia [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1237-1243. |
| [13] | Rongjun JIA,Liman MA,Lihua LI. Protective effect of calcitriol on hepatic fibrosis induced by bile duct ligation in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(2): 257-264. |
| [14] | YANG Fan, LI Lihua. Effect of vitamin D receptor activation on hepatic fibrosis induced by bile duct ligation in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2020, 46(04): 722-727. |
| [15] | YAO Hongyue, LIU Xinyu, LIU Wanzhu. Protective effect of panaxdiol on acute liver damage of rats induced by carbon tetrachloride and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2019, 45(03): 479-483. |