柯萨奇病毒A16型3C蛋白对人横纹肌肉瘤细胞凋亡的诱导作用及其机制

doi:10.13481/j.1671-587X.20210408

Abstract

Abstract: Objective

To investigate the effect of Coxsackievirus A16 3C protein on the apoptosis of rhabdomyosarcoma RD cells， and to illuminate its possible mechanism.

Methods

The RD cells were cultured in vitro and divided into control group （transfected with 0.4 μg pCMV-HA）， 0.1 μg pCMV-HA-3C group （transfected with 0.1 μg pCMV-HA-3C and 0.3 μg pCMV-HA）， 0.2 μg pCMV-HA-3C group （transfected with 0.2 μg pCMV-HA-3C and 0.2 μg pCMV-HA），0.4 μg pCMV-HA-3C group （transfected with 0.4 μg pCMV-HA-3C） and protein kinase B（AKT） activator SC79 treatment group （pretreated with 4 mg·L^－1　SC79 for 4 h， then transfected with 0.2 μg pCMV-HA-3C and 0.2 μg pCMV-HA）.The survival rates of cells in various groups were detected by MTT assay，the apoptotic rates were detected by flow cytometry， the expression levels of Bcl-2 homologous antagonist /killer （Bak），Bcl-2 associated agonist of cell death （Bad） and p53 up-regulated modulator of apoptosis （PUMA） mRNA were detected by Real-time fluorescence quantitative PCR （RT-qPCR），and the expression levels of Bad， Bak， PUMA， PARP， cleaved-PARP， cleaved-caspase-3 and phosphorylated AKT （p-AKT） proteins in the RD cells in various groups were detected by Western blotting method.

Results

Compared with control group， the survival rate of the cells 0.4 μg pCMV-HA-3C group was significantly decreased （P<0.01）. Compared with control group， the apoptotic rate of the cells in pCMV-HA-3C group was significantly increased （P<0.01）. Compared with control group，the mRNA and protein expression levels of Bak， Bad and PUMA in 0.2 μg PCMV-HA-3C group were significantly increased （P<0.05）， and the expression levels of cleaved-PARP and cleaved-caspase-3 proteins in different doses of pCMV-HA-3C groups were significantly increased （P<0.05）.Compared with control group， the expression levels of cleaved-PARP and cleaved-caspase-3 proteins in 0.2 μg pCMV-HA-3C group were significantly increased （P<0.05），and the expression level of p-AKT protein was significantly decreased （P<0.01）. Compared with 0.2 μg pCMV-HA-3C group，the the expression levels of cleaved-PARP，cleaved-caspase-3 and AKT proteins in the cells in SC79 treatment group were significantly decreased（P<0.05），and the p-AKT protein expression level was significantly increased （P<0.01）.

Conclusion

Coxsackievirus A16 3C protein may induce the apoptosis of RD cells by inhibiting AKT signaling pathway.

Key words: Coxsackievirus A16, 3C protein, protein kinase B signaling pathway, apoptosis

CLC Number:

R373.23

Yingying SHI,Shitong CHEN,Bo HU,Duo SHEN,Kuang ZHU,Siwei YE,Jinmei FENG. Induction of 3C protein of Coxsackievirus A16 in apoptosis of human rhabdomyosarcoma cells and its mechanism[J].Journal of Jilin University(Medicine Edition), 2021, 47(4): 874-881.

Figures/Tables 10

Tab. 1

Fig. 1

Tab. 2

Fig. 2

Fig. 3

Tab. 3

Fig.4

Tab.4

Fig. 5

Tab. 5

References 22

1	MAO Q Y， WANG Y P， YAO X， et al. Coxsackievirus A16： epidemiology， diagnosis， and vaccine［J］. Hum Vaccines Immunother， 2014， 10（2）： 360-367.
2	ZHANG M， ZHAO Y L， ZHANG H H， et al. Molecular characterization of Coxsackievirus A16 strains isolated from children with severe hand， foot， and mouth disease in Yunnan， Southwest China， during 2009-2015［J］. J Med Virol， 2019， 91（1）： 155-160.
3	ASTRUP B S， JOHNSEN I B， ENGSBRO A L. The role of Coxsackievirus A16 in a case of sudden unexplained death in an infant-A SUDI case［J］. Forensic Sci Int， 2016，259： e9-e13.
4	KVANSAKUL M. Viral infection and apoptosis［J］. Viruses， 2017， 9（12）： 356.
5	SHIM J M， KIM J， TENSON T， et al. Influenza virus infection， interferon response， viral counter-response， and apoptosis［J］. Viruses， 2017， 9（8）： E223.
6	ZHU G， ZHENG Y， ZHANG L， et al. Coxsackievirus A16 infection triggers apoptosis in RD cells by inducing ER stress［J］. Biochem Biophys Res Commun， 2013，441（4）：856-861.
7	SHI Y Y， HE X H， ZHU G G， et al. Coxsackievirus A16 elicits incomplete autophagy involving the mTOR and ERK pathways［J］. PLoS One， 2015， 10（4）： e0122109.
8	LU G W， QI J X， CHEN Z J， et al. Enterovirus 71 and coxsackievirus A16 3C proteases： binding to rupintrivir and their substrates and anti-hand， foot， and mouth disease virus drug design［J］. J Virol， 2011， 85（19）： 10319-10331.
9	RAMAJAYAM R， TAN K P， LIANG P H. Recent development of 3C and 3CL protease inhibitors for anti-coronavirus and anti-picornavirus drug discovery［J］. Biochem Soc Trans， 2011，39（5）：1371-1375.
10	RUI Y J， SU J M， WANG H， et al. Disruption of MDA5-mediated innate immune responses by the 3C proteins of coxsackievirus A16， coxsackievirus A6， and enterovirus D68［J］. J Virol， 2017， 91（13）： e00546.
11	LI J， YAO Y F， CHEN Y， et al. Enterovirus 71 3C promotes apoptosis through cleavage of PinX1， a telomere binding protein［J］. J Virol， 2017， 91（2）： e02016.
12	REN Y J， SHU T， WU D， et al. The ORF3a protein of SARS-CoV-2 induces apoptosis in cells［J］. Cell Mol Immunol， 2020， 17（8）： 881-883.
13	XU Y S， VICTORIO C B L， MENG T， et al. The saffold virus-Penang 2B and 3C proteins， but not the L protein， induce apoptosis in HEp-2 and vero cells［J］. Virol Sin， 2019， 34（3）： 262-269.
14	ADAMS J M， CORY S. The Bcl-2 protein family： arbiters of cell survival［J］. Science， 1998，281（5381）：1322-1326.
15	KAZI A， SUN J， DOI K， et al. The BH3 alpha-helical mimic BH3-M6 disrupts Bcl-X（L）， Bcl-2， and MCL-1 protein-protein interactions with Bax， Bak， Bad， or Bim and induces apoptosis in a Bax- and Bim-dependent manner［J］. J Biol Chem， 2011，286（11）：9382-9392.
16	DANG Y N， ZHANG Y F， XU L Y， et al. PUMA-mediated epithelial cell apoptosis promotes Helicobacter pylori infection-mediated gastritis［J］. Cell Death Dis， 2020， 11（2）： 139.
17	BOULARES A H， YAKOVLEV A G， IVANOVA V，et al. Role of poly（ADP-ribose） polymerase （PARP） cleavage in apoptosis. Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells［J］. J Biol Chem， 1999，274（33）：22932-22940.
18	CHOUDHARY G S， AL-HARBI S， ALMASAN A. Caspase-3 activation is a critical determinant of genotoxic stress-induced apoptosis［J］. Methods Mol Biol， 2015，1219： 1-9.
19	FRANKE T F， HORNIK C P， SEGEV L， et al. PI3K/Akt and apoptosis： size matters［J］. Oncogene， 2003，22（56）：8983-8998.
20	BROTELLE T， BAY J O. PI3K-AKT-mTOR pathway： Description， therapeutic development， resistance， predictive/prognostic biomarkers and therapeutic applications for cancer［J］. Bull Cancer， 2016，103（1）：18-29.
21	PONNUSAMY L， KOTHANDAN G， MANOHARAN R. Berberine and Emodin abrogates breast cancer growth and facilitates apoptosis through inactivation of SIK3-induced mTOR and Akt signaling pathway［J］. Biochim Biophys Acta Mol Basis Dis， 2020，1866（11）：165897.
22	ZHAI H， KANG Z H， ZHANG H B， et al. Baicalin attenuated substantia nigra neuronal apoptosis in Parkinson’s disease rats via the mTOR/AKT/GSK-3β pathway［J］. J Integr Neurosci， 2019， 18（4）： 423-429.

Gene	Primer sequence（5'－3'）
Bak	Forward AGGGCTTAGGACTTGGTTTG
Bak	Reverse GGGATTCCTAGTGGTGTTGATAG
Bad	Forward GGAGGATGAGTGACGAGTTTG
Bad	Reverse GGAGCTTTGCCGCATCT
PUMA	Forward GTGACCACTGGCATTCATTTG
PUMA	Reverse TCCTCCCTCTTCCGAGATTT
β-actin	Forward CACGATGGAGGGGCCGGACTCATC
β-actin	Reverse TAAAGACCTCTATGCCAACACAGT

Group	Survival rate
Control	90.00±5.98
pCMV-HA-3C 0.1 μg	85.83±5.71
0.2 μg	82.68±6.02
0.4 μg	65.09±3.78^*

Group	Bak		Bad		PUMA
Group	mRNA	Protein	mRNA	Protein	mRNA	Protein
Control	1.02±0.14	0.69±0.01	1.02±0.12	0.77±0.01	1.01±0.10	0.80±0.01
0.2 μg pCMV-HA-3C	1.54±0.11^*	0.78±0.01^**	1.72±0.05^**	0.83±0.01^*	1.73±0.19^*	0.85±0.01^*

Group	PARP	Cleaved- PARP	Cleaved- caspase-3
Control pCMV-HA-3C	0.88±0.01	0.71±0.01	0.55±0.01
0.1 μg	0.86±0.01	0.75±0.01^*	0.60±0.01^*
0.2 μg	0.82±0.07	0.77±0.01^*	0.68±0.01^*
0.4 μg	0.70±0.02^**	0.99±0.03^**	0.88±0.03^**

Group	Cleaved-PARP	Cleaved-caspase-3	AKT	p-AKT
Control	0.82±0.01	0.81±0.01	1.02±0.02	0.98±0.01
0.2 μg pCMV-HA-3C	1.07±0.01^*	1.16±0.02^*	1.10±0.01^*	0.82±0.01^**
SC79 treatment	0.84±0.01^ΔΔ	0.97±0.04^Δ	0.94±0.01^ΔΔ	1.10±0.01^ΔΔ

Induction of 3C protein of Coxsackievirus A16 in apoptosis of human rhabdomyosarcoma cells and its mechanism

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 10

References 22

Related Articles 15

Metrics

Comments

Recommended 10

[1]	Yang LI,Shiyang LI,Hongmei ZHANG,Qianqian LIU,Yubing CHEN. Effect of NGFR gene expression differences on promotion of apoptosis of squamous cell carcinoma and adenocarcinoma cells by PD-1 inhibitor-activated T lymphocytes [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 680-693.
[2]	Qiaotong REN,Weihua WU,Xingxiang WANG,Shichao WANG,Yipeng CHENG,Chun LI. Effect of interleukin-17 recepter B gene silencing on proliferation, invasion and apoptosis of lung adenocarcinoma A549 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 738-745.
[3]	Qiuping SU,Lei XING,Wei ZHANG,Shan JIANG,Yangyang ZHAO,Fangfang CHEN. Research progress in anti-tumor mechanism of berberine and application of its novel nano-delivery system in tumor therapy [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 863-871.
[4]	Jie YU,Zongkang WANG,Xun LIU,Yanan YANG,Jin TAN. Effect of miR-153-3p/PGC-1α axis on apoptosis of oral squamous cell carcinoma cells by modulation of mitochondrial apoptosis pathway [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 348-358.
[5]	Yaping LI,Chunyan TAN,Lujie ZHAO,Jiayi ZHAO,Ting LI,Xiao YANG,Xiaoyun YANG. Inductive effect of lysophosphatidic acid combined with 6-hydroxydopamine on apoptosis of SH-SY5Y cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 152-161.
[6]	Jiaxin WANG,Junwen MAO,Xuan ZHANG. Expression of natural autoantibodies against apoptosis inhibitory genes in plasma of patients with hepatocellular carcinoma and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 228-235.
[7]	Huaimin LIANG,Jiacheng JIN,Wenhua CHEN,Yuyao LI,Hangyu WANG,Ke ZHANG,Jinhui WANG. UPLC-Q-TOF/MS and network pharmacology analysis and experimental verification based on potential active ingredients and mechanisms of medicinal Mulberry Leaves in anti-acute kidney injury [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 56-69.
[8]	Shanshan SUN,Mei LU,Xinfu GAO,LYu Guangyao,Baolei Zhao,LYu Wenwen. Inhibitory effect of Bradykinin 1 receptor antagonist ELN441958 on proliferation of HepG2 cells by regulating Akt/FoxO3a signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 70-80.
[9]	Xiaohan YAO,Mingchen YAO,Zhiqing WANG,Heyang LI,Yan YAN,Ningjing LEI. Effect of silencing GPR139 gene on proliferation, apoptosis and autophagy of breast cancer cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 1-9.
[10]	Jianing WANG,Yongjuan LIU,Kaikai RAN,Binlian SUN,Yingying SHI. Prokaryotic expression, purification of coxsackievirus A16 Vp1 protein and preparation of rabbit polyclonal antibodies [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1717-1727.
[11]	Han XUE,Yuxin FAN,Ting ZHANG,Zhimin LI,Mingge HUO,Xingang GUAN. Preparation of nanodrug PTX₂ NPs and its killing effect on human lung cancer A549 cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1260-1266.
[12]	Jiarui LI,Zhenlin YANG,Fan GAO,Jingjing GUO,Jinzi LI. Effect of miR-34a-5p on hippocampal neuron apoptosis in rats with temporal lobe epilepsy and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 939-947.
[13]	Panxi SUN,Xue QIN,Chongyang ZHANG,Jia LUO,Yong CHEN,Lili WEI. Protective effect of TUG-891 on ischemic stroke induced by ischemia and hypoxia and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 968-975.
[14]	Cheng CHEN,Jingyao LI,Wanxiang HU,Donghui LIU,Zhihong CHEN. Protective effect of sericin on streptozotocin-induced INS-1 cell damage by regulating PI3K/Akt/NF-κB signaling pathway through Akt1 and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 590-598.
[15]	Donghui LIU,Yunzhe CI,Chunyan WANG,Wenyi MA. Effect of miR-199a-5p on expression of Caveolin-1, cell migration and apoptosis in glioma U251 cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 663-671.