兔脱细胞软骨基质颗粒复合SD大鼠脂肪干细胞对软骨内成骨的促进作用

doi:10.13481/j.1671-587X.20220406

Abstract

Abstract: Objective

To investigate the biocompatibility of rabbit acellular cartilage matrix particles （ACM）， and to clarify its promotion effect on the endochondral osteogenesis of adipose tissue-derived stem cells （ADSCs） in the SD rats.

Methods

The primary ADSCs of SD rabbits were extracted for three-dimensional differentiation and flow cytometry was used to detect the cell dryness.The ear cartilage of 3-month-old New Zealand white rabbits was collected and treated with grinding and soaking method to prepare ACM. The experiment was divided into ACM and ACM+ADSCs co-culture group.The ultrastructures of ACM and the ADSCs in ACM were observed under scanning electron microscope，and the growth status of ADSCs in ADSCs+ACM co-culture group was by Calcein-AM/PI fluorescence staining method. The ADSCs were divided into control group and experimental group（ADSCs and ACM co-culture）.The CCK-8 method was used to detect the proliferation activities of cells in two groups. Real-time fluorescence quantitative PCR （RT-qPCR） was used to detect expression levels of type Ⅱ collagen （COL-Ⅱ），type Ⅹ collagen （COL-Ⅹ）， SRY-related high mobility group-box 9 （SOX-9），vascular endothelial growth factor （VEGF）， alkaline phosphatase （ALP） and Runt-related transcription factor 2 （RUNX-2） mRNA in the ADSCs in two groups at 7 and 14 d of chondrogenic induction.

Results

The rabbit ACM was successfully prepared. The extracted ADSCs could differentiate in three ways and the specific surface markers of stem cells were expressed in the ADSCs. The ADSCs could adhere to ACM. Compared with control group， the proliferation activity of the cells in experimental group was increased （P<0.05）.The RT-qPCR results showed that compared with control group， the expression levels of VEGF，ALP and RUNX-2 mRNA in the ADSCs in experimental group were increased at 7 d of chondrogentic induction （P<0.05）， and the expression levels of COL-2， SOX-9， and COL-Ⅱ mRNA had no significant differences（P>0.05）. At 14 d of chondrogentic induction， compared with control group， the expression levels of VEGF， ALP， and RUNX-2 mRNA in the ADSCs in experimental group were increased （P<0.05），and the expression level of COL-Ⅹ mRNA was decreased （P<0.05）. Compared with 7 d of chodrogenic induction， the expression levels of VEGF， ALP， and RUNX-2 mRNA in the ADSCs in control group at 14 d of chodrogenic induction were decreased （P<0.05）， and the expression levels of COL-Ⅱ and COL-Ⅹ mRNA were increased （P<0.05）. Compared with 7 d of chondrogenic induction， the expression levels of COL-Ⅱ and COL-Ⅹ mRNA in the ADSCs in experimental group were increased at 14 d of chondrogenic induction （P<0.05）， while the expression levels of VEGF， ALP， and RUNX-2 mRNA were decreased（P<0.05）.

Conclusion

The rabbit ACM lack immunogenicity and have good biocompatibility and chondrogenic induction ability， which is beneficial to the occurrence of endochondral osteogenesis.

Key words: Adipose tissue-derived stem cells, Acellular cartilage matrix particles, Bone regeneration, Biomaterial

CLC Number:

Q813.1

Dongxiao BIAN,Xingfu BAO,Min HU. Promotion effect of rabbit acellular cartilage matrix particles combined with SD rat adipose tissue-derived stem cells on endochondral osteogenesis[J].Journal of Jilin University(Medicine Edition), 2022, 48(4): 883-891.

Figures/Tables 8

Tab.1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Tab.2

References 24

1	PARK C， KIM K H， LEE Y M， et al. Advanced engineering strategies for periodontal complex regeneration［J］. Materials， 2016， 9（1）： 57.
2	FARRELL E， BOTH S K， ODÖRFER K I， et al. In-vivo generation of bone via endochondral ossification by in-vitro chondrogenic priming of adult human and rat mesenchymal stem cells［J］. BMC Musculoskelet Disord， 2011， 12： 31.
3	PAPADIMITROPOULOS A， SCOTTI C， BOURGINE P，et al. Engineered decellularized matrices to instruct bone regeneration processes［J］. Bone， 2015， 70： 66-72.
4	MAES C. Role and regulation of vascularization processes in endochondral bones［J］. Calcif Tissue Int， 2013， 92（4）： 307-323.
5	STAMNITZ S， KLIMCZAK A. Mesenchymal stem cells， bioactive factors， and scaffolds in bone repair： from research perspectives to clinical practice［J］. Cells， 2021， 10（8）： 1925.
6	GAWLITTA D， BENDERS K E， VISSER J， et al. Decellularized cartilage-derived matrix as substrate for endochondral bone regeneration［J］. Tissue Eng Part A， 2015， 21（3/4）： 694-703.
7	KANG H J， LU S B， PENG J， et al. In vivo construction of tissue-engineered cartilage using adipose-derived stem cells and bioreactor technology［J］. Cell Tissue Bank， 2015， 16（1）： 123-133.
8	HUANG Y X， YU X F， HE L J， et al. 3D porous acellular cartilage matrix scaffold with surface mediated sustainable release of TGF-β3 for cartilage engineering［J］.Chin Chem Lett，2020，31（7）：1797-1800.
9	BAHNEY C S， HU D P， TAYLOR A J， et al. Stem cell-derived endochondral cartilage stimulates bone healing by tissue transformation［J］. J Bone Miner Res， 2014， 29（5）： 1269-1282.
10	SUGAWARA A， SATO S. Application of dedifferentiated fat cells for periodontal tissue regeneration［J］. Hum Cell， 2014， 27（1）： 12-21.
11	YANG Q， PENG J， GUO Q Y， et al. A cartilage ECM-derived 3-D porous acellular matrix scaffold for in vivo cartilage tissue engineering with PKH26-labeled chondrogenic bone marrow-derived mesenchymal stem cells［J］. Biomaterials， 2008， 29（15）： 2378-2387.
12	FENG X K， LI Z Y， WEI J H， et al. Injectable cartilaginous template transformed BMSCs into vascularized bone［J］. Sci Rep， 2018， 8（1）： 8244.
13	BENDERS K E M， RVAN WEEREN P， BADYLAK S F，et al. Extracellular matrix scaffolds for cartilage and bone regeneration［J］. Trends Biotechnol， 2013， 31（3）： 169-176.
14	BENDERS K E， BOOT W， COKELAERE S M，et al. Multipotent stromal cells outperform chondrocytes on cartilage-derived matrix scaffolds［J］.Cartilage， 2014，5（4）： 221-230.
15	HORIKOSHI S， KAJIYA M， MOTOIKE S， et al. Clumps of mesenchymal stem cells/extracellular matrix complexes generated with xeno-free chondro-inductive medium induce bone regeneration via endochondral ossification［J］. Biomedicines， 2021， 9（10）： 1408.
16	FARRELL E， O PVAN DER JAGT， KOEVOET W， et al. Chondrogenic priming of human bone marrow stromal cells： a better route to bone repair？［J］. Tissue Eng Part C Methods， 2009， 15（2）： 285-295.
17	杨艳兰徐普.干细胞修复牙槽骨缺损：微环境认知新进展［J］. 解放军医学杂志， 2021，46（4）： 404-409.
18	ZHAI C J， ZHANG X， CHEN J， et al. The effect of cartilage extracellular matrix particle size on the chondrogenic differentiation of bone marrow mesenchymal stem cells［J］. Regen Med， 2019， 14（7）： 663-680.
19	HERRMANN M， VERRIER S， ALINI M. Strategies to stimulate mobilization and homing of endogenous stem and progenitor cells for bone tissue repair［J］. Front Bioeng Biotechnol， 2015， 3： 79.
20	JEYAKUMAR V， AMRAISH N， NICULESCU-MORSZA E， et al. Decellularized cartilage extracellular matrix incorporated silk fibroin hybrid scaffolds for endochondral ossification mediated bone regeneration［J］. Int J Mol Sci， 2021， 22（8）： 4055.
21	AANEI C M， FLANDRIN P， ELOAE F Z， et al. Intrinsic growth deficiencies of mesenchymal stromal cells in myelodysplastic syndromes［J］. Stem Cells Dev， 2012， 21（10）： 1604-1615.
22	DONG J， ZHU G， WANG T C， et al. Ginsenoside Rg1 promotes neural differentiation of mouse adipose-derived stem cells via the miRNA-124 signaling pathway［J］.J Zhejiang Univ Sci B，2017，18（5）：445-448.
23	WANG Z J， AN R Z， ZHAO J Y， et al. Repair of articular cartilage defects by tissue-engineered cartilage constructed with adipose-derived stem cells and acellular cartilaginous matrix in rabbits［J］. Genet Mol Res， 2014， 13（2）： 4599-4606.
24	BORDBAR S， LOTFI BAKHSHAIESH N， KHANMOHAMMADI M， et al. Production and evaluation of decellularized extracellular matrix hydrogel for cartilage regeneration derived from knee cartilage［J］. J Biomed Mater Res A， 2020， 108（4）： 938-946.

Primer	Sequence(5'－3')
GAPDH	F：GCTCTCTGCTCCTCCCTGTTGTA R：GGCCAAATCCGTTCACACCG
COL-Ⅱ	F：AGAACTGGTGGAGCAGCACGA R：ATCTGGACGTTAGCGGTGTTG
SOX-9	F：ACAAGAAAGACCACCCCGATTA R：GTTAGGAGAGATGTGAGTCTGTTCG
COL-Ⅹ	F：CCATGGTTCACACAACCCCTT R：TGGCTGTGGTAAAGCACCTTG
VEGF	F：AAACCTCACCAAAGCCAGCACATAG R：AACATTTACACGTCTGCGGATCTTG
ALP	F：GGAGACGTCATCCTGGCTATC R：CGAGTTTCTGCCCTGTCAATC
RUNX-2	F：GGTACTTCGTCAGCGTCCTATC R：CATCAGCGTCAACACCATCA

Group	COL-Ⅱ mRNA	SOX-9 mRNA	COL-Ⅹ mRNA	VEGF mRNA	ALP mRNA	RUNX-2 mRNA
Control
7 d	1.00±0.07	1.00±0.11	1.01±0.12	0.02±0.01	1.00±0.09	1.00±0.04
14 d	2.05±0.19^△	0.77±0.32	1.55±0.09^△	0.01±0.01^△	0.10±0.01^△	0.13±0.01^△
Experimental
7 d	1.16±0.24	1.23±0.25	0.86±0.03	0.13±0.02^*	4.69±0.09^*	7.10±0.27^*△
14 d	2.59±0.07^△	0.93±0.12	1.16±0.08^*△	0.04±0.01^*△	1.75±0.11^*△	2.10±0.21^*△

[1]	Yang LIU,Shaobo ZHAI,Zheng YANG,Yuchuan WU,Xiaolu SHI,Shunli CHU. Flexible two-stage transalveolar technique for sinus floor elevation for resolution of severe bone height deficiency in maxillary posterior region： A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1370-1376.
[2]	Xingang LIU,Xu CHEN,Yadong LIU,Jinhu MIAO,Guoxi SHAO. Preparation of 3D-printed PLA/PTMC-Ca₃(PO₄)₂ composite scaffolds and their effects on osteogenic differentiation of bone marrow mesenchymal stem cells of rabbits [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1519-1525.
[3]	Ye TIAN,Xiaolu SHI,Shaobo ZHAI,Yang LIU,Zheng YANG,Yuchuan WU,Shunli CHU. Barrier function of PPC/PBS composite biofilm and its osteogenetic effect on tibial bone defect models of rabbits [J]. Journal of Jilin University(Medicine Edition), 2024, 50(4): 1016-1025.
[4]	Kewen JIA,Yuemeng ZHU,Siyu CHEN,Minghui LI,Jiaqian YOU,Sheng CHEN,Yanmin ZHOU. Application of autologous platelet-rich fibrin in immediate implant placement of molar with periapical periodontitis: A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2024, 50(2): 536-544.
[5]	Xiaolu SHI,Ye TIAN,Shaobo ZHAI,Yang LIU,Shunli CHU. Preparation of PPC/PBS-based guided bone regeneration membrane and evaluation of its physiochemical properties and biological characteristics [J]. Journal of Jilin University(Medicine Edition), 2023, 49(6): 1473-1483.
[6]	Qingyu ZHANG,Tingrui XU,Junjun JIAO,Degeng XIA,Tianyi ZHANG,Li ZHANG,Ning MA. Preparation method of platelet-rich fibrin and hydroxyapatite complex and property evaluation [J]. Journal of Jilin University(Medicine Edition), 2022, 48(6): 1448-1454.
[7]	Degeng XIA,Qingyu ZHANG,Junjun JIAO,Tingrui XU,Tianyi ZHANG,Yang ZHONG,Zhulan ZHAO,Ning MA,Li ZHANG. Multidisciplinary aesthetic restoration of anterior dental area of patient with failed treatment experience: A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2022, 48(4): 1058-1064.
[8]	Zhulan ZHAO,Qingyu ZHANG,Degeng XIA,Yang ZHONG,Tianyi ZHANG,Yu HUANG,Li ZHANG,Ning MA. Clinical repair effect of combined orthodontic treatment with implant prosthesis in severe invasive periodontitis：A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1292-1297.
[9]	HUANG Yu, ZHAO Zhulan, ZHONG Yang, XU Lishuo, LIU Chenguang, MA Ning, ZHANG Li. Soft tissue augmentation and bone regeneration combined with immediate implantation of patient with severe chronic periodontitis:A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2020, 46(05): 1082-1086.
[10]	KONG Weijian, FANG Hongjuan, PAN Su, YANG Lili, ZHENG Shuang, QI Zhiping, FU Chuan, ZHONG Lei. Effect of PLGA electrospinning membrane carrying paclitaxel-liposomes on proliferation and differentiation of neural stem cells [J]. Journal of Jilin University(Medicine Edition), 2020, 46(03): 509-514.
[11]	JIAO Peng, CHEN Fei, JIN Quan, CHEN Nannan, ZHANG Li, MA Ning. Comprehensive treatment of anterior esthetic zone in patient with loosening and falling of teeth induced by severe periodontitis: A case reeport and literature review [J]. Journal of Jilin University Medicine Edition, 2018, 44(02): 421-424.
[12]	CHEN Fei, SHI Jinxian, JIAO Peng, JIN Quan, XU Lishuo, ZHANG Li, MA Ning. Periodontal surgical treatment in patient with residual root and crown of anterior teeth induced by unfitting prosthesis: A case report and literature review [J]. Journal of Jilin University Medicine Edition, 2018, 44(01): 170-174.
[13]	GAO Xin，HE Zhong-qin，WANG Cheng-kun,ZHANG Zhi-min，WANG Zhi-gang,ZHONG Cheng,OUYANG Jie. Physicochemical characteristics of calcinated bone ceramics used for bone defects repair [J]. J4, 2009, 35(1): 138-141.

Promotion effect of rabbit acellular cartilage matrix particles combined with SD rat adipose tissue-derived stem cells on endochondral osteogenesis

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 8

References 24

Related Articles 13

Metrics

Comments

Recommended 10