Journal of Jilin University(Medicine Edition) ›› 2024, Vol. 50 ›› Issue (1): 33-41.doi: 10.13481/j.1671-587X.20240105
• Research in basic medicine • Previous Articles Next Articles
Yan WANG,Xiaohui LI,Yao JI,Lili CUI,Yujie CAI(
)
Received:2023-03-17
Online:2024-01-28
Published:2024-01-31
Contact:
Yujie CAI
E-mail:caiyujie@gdmu.edu.cn
CLC Number:
Yan WANG,Xiaohui LI,Yao JI,Lili CUI,Yujie CAI. Differential effects of APOE polymorphism in neurotoxicity-responsive astrocytes induced by inflammatory factor[J].Journal of Jilin University(Medicine Edition), 2024, 50(1): 33-41.
Tab. 1
Primer sequences of RT-qPCR"
| Primer | Sequence(5'-3') |
|---|---|
| Gpc4 | F:CTCAAGTCGAAAAGTTGCTCGG |
| R:TGGTCACCGTTGATCTCATAGA | |
| Gpc6 | F: TCCGGGCTGTGATTCTTCCT |
| R: CCTTGGCACCGTAAGCCTG | |
| Sparcl1 | F: GGCAATCCCGACAAGTACAAG |
| R: TGTAGCGTCTTCCGGTGTCA | |
| Thbs1 | F: CCTGCCAGGGAAGCAACAA |
| R: ACAGTCTATGTAGAGTTGAGCCC | |
| Thbs2 | F: CTGGGCATAGGGCCAAGAG |
| R: GTCTTCCGGTTAATGTTGCTGAT | |
| GDNF | F: TTCCTGGCTGTTACGTTAAGC |
| R: GCCATTTGCATCAATCAAGCA | |
| C3 | F: GCAGAGACCCTACGGGTGA |
| R: GGTGGCATCTTCGGTCGTG | |
| S100B | F: TGGTTGCCCTCATTGATGTCT |
| R: CCCATCCCCATCTTCGTCC | |
| GAPDH | F: AAGAGGGATGCTGCCCTTAC |
| R: TACGGCCAAATCCGTTCACA |
| 1 | JIA L F, DU Y F, CHU L, et al. Prevalence, risk factors, and management of dementia and mild cognitive impairment in adults aged 60 years or older in China: a cross-sectional study [J].Lancet Public Health,2020,5(12): e661-e671 |
| 2 | KHAN S, BARVE K H, KUMAR M S. Recent advancements in pathogenesis, diagnostics and treatment of Alzheimer’s disease [J]. Curr Neuropharmacol, 2020, 18(11):1106-1125. |
| 3 | SELKOE D J, HARDY J. The amyloid hypothesis of Alzheimer’s disease at 25 years [J]. EMBO Mol Med, 2016, 8(6):595-608. |
| 4 | BAKOTA L, BRANDT R. Tau biology and tau-directed therapies for Alzheimer’s disease [J]. Drugs, 2016, 76(3):301-313. |
| 5 | GUO T T, ZHANG D H, ZENG Y Z, et al. Molecular and cellular mechanisms underlying the pathogenesis of Alzheimer’s disease [J]. Mol Neurodegener, 2020, 15(1):40. |
| 6 | RICHARD A A. Risk factors for Alzheimer’s disease [J]. Folia Neuropathol, 2019, 57(2):87-105. |
| 7 | HERSI M, IRVINE B, GUPTA P, et al. Risk factors associated with the onset and progression of Alzheimer’s disease: A systematic review of the evidence [J]. Neurotoxicology, 2017, 61:143-187. |
| 8 | JEONG W, LEE H, CHO S, et al. ApoE4-induced cholesterol dysregulation and its brain cell type-specific implications in the pathogenesis of Alzheimer’s disease [J]. Mol Cells, 2019, 42(11):739-746. |
| 9 | CALSOLARO V, EDISON P.Neuroinflammation in Alzheimer’s disease: Current evidence and future directions[J].Alzheimers Dement,2016,12(6):719-732. |
| 10 | AMAIA M A, BART D S. The role of astroglia in Alzheimer’s disease: pathophysiology and clinical implications [J]. Lancet Neurol, 2019, 18(4):406-414. |
| 11 | SCHILDGE S, BOHRER C, BECK K, et al. Isolation and culture of mouse cortical astrocytes [J]. J Vis Exp, 2013, 71:50079. |
| 12 | WHO. World failing to address dementia challenge, News release[R/OL].(2021-09-02)[2021-09-02].. |
| 13 | CHUN H, IM H, KANG Y J, et al. Severe reactive astrocytes precipitate pathological hallmarks of Alzheimer’s disease via H2O2-production [J]. Nat Neurosci, 2020, 23(12):1555-1566. |
| 14 | KAUR D, SHARMA V, DESHMUKH R. Activation of microglia and astrocytes: a roadway to neuroinflammation and Alzheimer’s disease [J]. Inflammopharmacology, 2019, 27(4):663-677. |
| 15 | SHANE A L, KEVIN A G, LAURA E C, et al. Neurotoxic reactive astrocytes are induced by activated microglia [J]. Nature, 2017, 541(7638):481-487. |
| 16 | CLARKE L E, LIDDELOW S A, CHANDRANI C, et al. Normal aging induces A1-like astrocyte reactivity [J]. Proc Natl Acad Sci USA, 2018, 115(8):E1896-E1905. |
| 17 | ROOA A R, MONTOLIU-GAYA L, VILLEGAS S.The role of apolipoprotein E isoforms in Alzheimer’s disease [J]. J Alzheimers Dis, 2019, 68(2):459-471. |
| 18 | LIN Y T, SEO J, GAO F, et al. APOE4 causes widespread molecular and cellular alterations associated with Alzheimer’s disease Phenotypes in human iPSC-derived brain cell types [J]. Neuron, 2018, 98(6):1294. |
| [1] | Yan ZHAO,Huawei WU. Promotion effect of overexpression of circ_ITCH on repairment of spinal cord injury by regulating astrocyte activation in rats [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 633-640. |
| [2] | Jingxin WANG,Yuejuan GAO,Jingnan ZHANG,Jiawen NIU,Chunhua JIN. Effect of sesamin on learning and memory abilities of rats with Alzheimer’s disease model through regulating AMPK/SIRT1 autophagy pathway [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 663-671. |
| [3] | Yang LI,Shiyang LI,Hongmei ZHANG,Qianqian LIU,Yubing CHEN. Effect of NGFR gene expression differences on promotion of apoptosis of squamous cell carcinoma and adenocarcinoma cells by PD-1 inhibitor-activated T lymphocytes [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 680-693. |
| [4] | Qiaotong REN,Weihua WU,Xingxiang WANG,Shichao WANG,Yipeng CHENG,Chun LI. Effect of interleukin-17 recepter B gene silencing on proliferation, invasion and apoptosis of lung adenocarcinoma A549 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 738-745. |
| [5] | Qiuping SU,Lei XING,Wei ZHANG,Shan JIANG,Yangyang ZHAO,Fangfang CHEN. Research progress in anti-tumor mechanism of berberine and application of its novel nano-delivery system in tumor therapy [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 863-871. |
| [6] | Jie YU,Zongkang WANG,Xun LIU,Yanan YANG,Jin TAN. Effect of miR-153-3p/PGC-1α axis on apoptosis of oral squamous cell carcinoma cells by modulation of mitochondrial apoptosis pathway [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 348-358. |
| [7] | Yaping LI,Chunyan TAN,Lujie ZHAO,Jiayi ZHAO,Ting LI,Xiao YANG,Xiaoyun YANG. Inductive effect of lysophosphatidic acid combined with 6-hydroxydopamine on apoptosis of SH-SY5Y cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 152-161. |
| [8] | Jiaxin WANG,Junwen MAO,Xuan ZHANG. Expression of natural autoantibodies against apoptosis inhibitory genes in plasma of patients with hepatocellular carcinoma and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 228-235. |
| [9] | Huaimin LIANG,Jiacheng JIN,Wenhua CHEN,Yuyao LI,Hangyu WANG,Ke ZHANG,Jinhui WANG. UPLC-Q-TOF/MS and network pharmacology analysis and experimental verification based on potential active ingredients and mechanisms of medicinal Mulberry Leaves in anti-acute kidney injury [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 56-69. |
| [10] | Shanshan SUN,Mei LU,Xinfu GAO,LYu Guangyao,Baolei Zhao,LYu Wenwen. Inhibitory effect of Bradykinin 1 receptor antagonist ELN441958 on proliferation of HepG2 cells by regulating Akt/FoxO3a signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 70-80. |
| [11] | Yan ZHAO,Huawei WU. Inhibitory effect of inhibition of miR-17-5p on proliferation of spinal cord astrocytes of rats induced by scratch injury through targeting Mfn2 expression [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 81-92. |
| [12] | Xiaohan YAO,Mingchen YAO,Zhiqing WANG,Heyang LI,Yan YAN,Ningjing LEI. Effect of silencing GPR139 gene on proliferation, apoptosis and autophagy of breast cancer cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 1-9. |
| [13] | Han XUE,Yuxin FAN,Ting ZHANG,Zhimin LI,Mingge HUO,Xingang GUAN. Preparation of nanodrug PTX2 NPs and its killing effect on human lung cancer A549 cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1260-1266. |
| [14] | Weiqi SUN,Lingyu ZHU,Xiaolei XU,Ying LIU,Hongmei LYU,Yahui LAI. Expressions of peripheral blood related biological markers in elderly patients with Alzheimer’s disease and intervention effect of selenium-rich food [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1333-1339. |
| [15] | Linrui XU,Yiyu ZHANG,Jiaqi CUI,Xianzhu CONG,Shuang LI,Jiayu GE,Yujia KONG,Suzhen WANG,Fuyan SHI,Jinrong WANG. Construction of diagnostic model for Alzheimer’s disease and immune analysis based on bioinformatics and machine learning [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 1039-1051. |