Journal of Jilin University(Medicine Edition) ›› 2024, Vol. 50 ›› Issue (3): 620-627.doi: 10.13481/j.1671-587X.20240305
• Research in basic medicine • Previous Articles Next Articles
Yingqun NI1,2,3(
),Mao YANG1,Di YANG1,Chenglin GUO1,Wenjun ZHU4,Yaqin YU4,Qin LU4,Jinzhi LUO4,Chunqin WU4,Zhaohui FANG1,2,3
Received:2023-06-30
Online:2024-05-28
Published:2024-07-01
Contact:
Yingqun NI
E-mail:Jessica8163@126.com
CLC Number:
Yingqun NI,Mao YANG,Di YANG,Chenglin GUO,Wenjun ZHU,Yaqin YU,Qin LU,Jinzhi LUO,Chunqin WU,Zhaohui FANG. Screening of key differentially expressed genes involved in osteogenic differentiation of lower limb vascular smooth muscle cells and validation[J].Journal of Jilin University(Medicine Edition), 2024, 50(3): 620-627.
Tab. 1
Primer sequences"
| Gene | Primer sequence(5'-3') | |
|---|---|---|
| ALP | Forward | GTGGTATTGTAGGTGCTGTGGTC |
| Reverse | ACGGTGTCGTAGCCTTCTGG | |
| BMP2 | Forward | GTTCTGTCCCTACTGATGAGTTTCT |
| Reverse | CTGGCTGTGGCAGGCTTTAT' | |
| α-SMA | Forward | GGGCATCCACGAAACCACCT |
| Reverse | GAGCCGCCGATCCAGACAGA | |
| TP53 | Forward | GCCATCTACAAGAAGTCACAACAC |
| Reverse | TGTCGTCCAGATACTCAGCATAC | |
| GPX4 | Forward | CAATGAGGCAAAACCGACGTA |
| Reverse | CCTCCCGAACTGGTTGCAAG | |
| Ftl1 | Forward | CAGCCTGGTCAATTTGTACCT |
| Reverse | GCCAATTCGCGGAAGAAGTG | |
| GPLD1 | Forward | GGTGGGCTCGAGCAT |
| Reverse | GCACCTTTGTAGGTGAGCAG |
| 1 | ALMAN A C, MAAHS D M, REWERS M J, et al. Ideal cardiovascular health and the prevalence and progression of coronary artery calcification in adults with and without type 1 diabetes[J]. Diabetes Care, 2014, 37(2): 521-528. |
| 2 | BERRY C, TARDIF J C, BOURASSA M G. Coronary heart disease in patients with diabetes: part Ⅰ: recent advances in prevention and noninvasive management[J]. J Am Coll Cardiol, 2007, 49(6): 631-642. |
| 3 | YAHAGI K, KOLODGIE F D, LUTTER C, et al. Pathology of human coronary and carotid artery atherosclerosis and vascular calcification in diabetes mellitus[J]. Arterioscler Thromb Vasc Biol, 2017, 37(2): 191-204. |
| 4 | WANG P W, PANG Q, ZHOU T, et al. Irisin alleviates vascular calcification by inhibiting VSMC osteoblastic transformation and mitochondria dysfunction via AMPK/Drp1 signaling pathway in chronic kidney disease[J]. Atherosclerosis, 2022, 346: 36-45. |
| 5 | SÁNCHEZ-DUFFHUES G, GARCÍA DE VINUESA A, VAN DE POL V, et al. Inflammation induces endothelial-to-mesenchymal transition and promotes vascular calcification through downregulation of BMPR2[J]. J Pathol, 2019, 247(3): 333-346. |
| 6 | LIU Q, LUO Y, ZHAO Y, et al. Nano-hydroxyapatite accelerates vascular calcification via lysosome impairment and autophagy dysfunction in smooth muscle cells[J]. Bioact Mater, 2021, 8: 478-493. |
| 7 | AHN B Y, JEONG Y, KIM S, et al. Cdon suppresses vascular smooth muscle calcification via repression of the Wnt/Runx2 Axis[J]. Exp Mol Med, 2023, 55(1): 120-131. |
| 8 | YE Y Z, CHEN A, LI L, et al. Repression of the antiporter SLC7A11/glutathione/glutathione peroxidase 4 axis drives ferroptosis of vascular smooth muscle cells to facilitate vascular calcification[J]. Kidney Int, 2022, 102(6): 1259-1275. |
| 9 | WANG Z Q, JIANG Y C, LIU N F, et al. Advanced glycation end-product Nε-carboxymethyl-Lysine accelerates progression of atherosclerotic calcification in diabetes[J]. Atherosclerosis, 2012, 221(2): 387-396. |
| 10 | 高 敏, 陈天雷, 吴 琳, 等. 吡格列酮通过 Wnt/β-catenin信号通路减轻大鼠血管平滑肌细胞钙化[J]. 肾脏病与透析肾移植杂志, 2016, 25(4): 340-346. |
| 11 | YAO H P, SUN Z, ZANG G Y, et al. Epidemiological research advances in vascular calcification in diabetes[J]. J Diabetes Res, 2021, 2021: 4461311. |
| 12 | VOELKL J, LANG F, ECKARDT K U, et al. Signaling pathways involved in vascular smooth muscle cell calcification during hyperphosphatemia[J]. Cell Mol Life Sci, 2019, 76(11): 2077-2091. |
| 13 | KONG Y L, LIANG Q C, CHEN Y T, et al. Hyaluronan negatively regulates vascular calcification involving BMP2 signaling[J]. Lab Invest, 2018, 98(10): 1320-1332. |
| 14 | MASUDA S, FUJISHIMA Y, MAEDA N, et al. Impact of glycosylphosphatidylinositol-specific phospholipase D on hepatic diacylglycerol accumulation, steatosis, and insulin resistance in diet-induced obesity[J]. Am J Physiol Endocrinol Metab, 2019, 316(2): E239-E250. |
| 15 | RAIKWAR N S, BOWEN-DEEG R F, DU X S, et al. Glycosylphosphatidylinositol-specific phospholipase D improves glucose tolerance[J]. Metabolism, 2010, 59(10): 1413-1420. |
| 16 | TORRETTA S, RAMPINO A, BASSO M, et al. NURR1 and ERR1 modulate the expression of genes of a DRD2 coexpression network enriched for schizophrenia risk[J]. J Neurosci, 2020, 40(4): 932-941. |
| 17 | ABDOLMALEKI F, HEIDARIANPOUR A. Endurance exercise training restores diabetes-induced alteration in circulating Glycosylphosphatidylinositol-specific phospholipase D levels in rats[J]. Diabetol Metab Syndr, 2020, 12: 43. |
| 18 | QIN W, LIANG Y Z, QIN B Y, et al. The clinical significance of glycoprotein phospholipase D levels in distinguishing early stage latent autoimmune diabetes in adults and type 2 diabetes[J]. PLoS One, 2016, 11(6): e0156959. |
| 19 | SCHOFIELD J N, STEPHENS J W, HUREL S J, et al. Insulin reduces serum glycosylphosphatidylinositol phospholipase D levels in human type I diabetic patients and streptozotocin diabetic rats[J]. Mol Genet Metab, 2002, 75(2): 154-161. |
| 20 | WANG K, CHEN X Z, WANG Y H, et al. Emerging roles of ferroptosis in cardiovascular diseases[J]. Cell Death Discov, 2022, 8(1): 394. |
| 21 | ZHAO L L, YANG N, SONG Y Q, et al. Effect of iron overload on endothelial cell calcification and its mechanism[J]. Ann Transl Med, 2021, 9(22): 1658. |
| [1] | Junjie TAN,Jie ZHAO,Shenyi LIU,Huayang DENG,Yideng ZHAO,Tuo ZHU,Hailan ZHAN,Lihua RUAN. Effect of silencing XBP1 on recovery of neurological function in rats with spinal cord injury by regulating Nrf2-mediated ferroptosis [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 641-650. |
| [2] | Zheng TANG,Wei LIU,Hongmin HU,Qi LAI,Yan SHI,Shengquan LIU,Jun YANG,Chun CHU. Improvement effect of Qishen Yiqi dropping pills on myocardium injury in rats induced by sorafenib and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 308-317. |
| [3] | Ziyi TANG,Shiying YANG,Tianzhen YANG,Wenqiang LIU,Jiangxue ZHONG,Li YIN. Induction effect of pesticide pyraclostrobin on ferroptosis of spermatocytes GC-2 of mice [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 18-25. |
| [4] | Xiaoxue HU,Xiaowen AI,Anna YANG,Yonglan ZHANG. Effect of iprodione on ferroptosis in spermatocytes GC-2 of mice [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 26-34. |
| [5] | Huiyuan YU,Ling JIN,Ying YU,Xue WANG,Bing WANG. Improvement effect of epicatechin on liver injury in mice induced by acetaminophen and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1498-1507. |
| [6] | Wei ZHONG,Zhiyin DAI,Xinggang CUI,Bo LI,Yu JIANG. Effect of nuclear factor of activated T lymphocytes 5 on senescence of smooth muscle cells of mice induced by high-salt and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 567-575. |
| [7] | Han LIN,Qiuyan YANG,Jieyue ZHONG,Bolun CHEN,Wangxia TONG. Improvement effect of cordycepin on ferroptosis in HepG2 cells induced by RSL3 and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 576-589. |
| [8] | Liang LI,Xiangdong ZHOU,Jie WANG,Chaoqun XU,Mengxia ZHU,Shanjun YU,Qi LI. Effect of bitter-taste receptor T2R38 activation on ferroptosis of human airway epithelium NuLi-1 cells induced by cigarette smoke exposure and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 333-340. |
| [9] | Kaiqi NIU,He CHANG,Guangfu LYU,Pengyu ZHENG,Xueting CHI,Jia ZHOU,Yuchen WANG,Xiaowei HUANG. Inhibitory effect of astragaloside Ⅳ on cisplatin-induced liver injury in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 370-377. |
| [10] | Yaqi ZHANG,Jing MI,Jingrong YANG,Xinming LI,Li LI. Effect of up-regulation of miR-31 expression on osteogenic differentiation of dental pulp stem cells through Wnt-β/catenin signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 412-419. |
| [11] | Baolian MA,Xiaoxue HU,Xiaowen AI,Yonglan ZHANG. Inhibitory effect of diosmetin on ferroptosis of GC-2 spermatocytes induced by RSL3 in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1481-1490. |
| [12] | Guobin HE,Huan WANG. Effect of knockdown of RIP3 on autophagy, pyroptosis, and ferroptosis of hypoxia/reoxygenation-induced human renal tubular epithelial HK2 cells [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1644-1653. |
| [13] | Fangyang JIANG,Jing XIAO,He CHANG,Mingyang SUN,Wenjing ZHANG,Guangfu LYU,He LIN,Zhe LIN,Xiaowei HUANG,Yuchen WANG. Effect of polygonatum odoratum polysaccharide on acute kidney injury in mice induced by cisplatin and its ferroptosis mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(5): 1235-1242. |
| [14] | Yanjue YE,Ziyi TANG,Yupei TAN,Shiying YANG,Yong LIU,Li YIN. Effect of azathioprine on ferroptosis in spermatocytes of mice induced by RSL3 [J]. Journal of Jilin University(Medicine Edition), 2024, 50(5): 1217-1226. |
| [15] | Xiaoyong PENG,Yu ZHU,Shuangbo ZHANG,Yingguo ZHU,Tao LI,Liangming LIU,Jianmin WANG,Guangming YANG. Alleviative effect of fluid resuscitation on damage of structure injury of vascular cells after blast injury complicated with hemorrhagic shock in rats by inhibiting ferroptosis of vascular tissue [J]. Journal of Jilin University(Medicine Edition), 2024, 50(5): 1227-1234. |