白藜芦醇对颞下颌关节骨关节炎的治疗作用及其机制

doi:10.13481/j.1671-587X.20240608

Abstract

Abstract:

Objective To discuss the therapeutic effect of resveratrol on the temporomandibular joint osteoarthritis （TMJOA）， and to clarify the related mechanism. Methods Forty-five SD rats were randomly divided into control group， model group， and resveratrol group， and there were 15 rats in each group. The rats in model group and resveratrol group were intra-articularly injected with 50 μL of 20 g·L^-1 monosodium iodoacetate （MIA） to set TMJOA rat models， while the rats in control group were injected with an equal volume of normal saline. Three weeks after modeling， the rats in resveratrol group received an injection of 80 μL resveratrol solution， once a week for three weeks， while the rats in control and model groups were injected with an equal volume of normal saline. Micro-computed tomography （Micro-CT） system was used to detect the condyle structure and the bone volume fraction （BV/TV）， trabecular thickness （Tb.Th）， trabecular spacing （Tb.Sp）， and trabecular number （Tb.N） of the rats in various groups were calculated； HE staining and toluidine blue staining were used to observe the pathomorphology of temporomandibular joint （TMJ） tissue of the rats in various groups； immunohistochemistry was used to detect the expression levels of SRY-related HMG box （SOX）-9， matrix metalloproteinase （MMP）-13， silent information regulator （Sirt）1， phosphatidylinositol 3-kinase （PI3K）， phosphorylated protein kinase B （p-Akt）， and phosphorylated mammalian target of rapamycin （p-mTOR） in TMJ tissue of the rats in various groups； real-time quantitative PCR （RT-qPCR） method was used to detect the expression levels of SOX-9， MMP-13， Sirt1， PI3K， mTOR， and Akt mRNA in TMJ tissue of the rats in various groups. Results Three weeks after modeling， condylar bone was destructed， the surface was roughness， and continuity interruption were observed， indicating TMJOA model of the rats was established successfully. The Micro-CT system results showed that the condylar surface of the rats in control group was smooth and regularly shaped， with continuous bone texture； the rats in model group had significant condylar destruction， disrupted continuity， surface roughness， and varying degrees of bone defects； the rats in resveratrol group showed alleviated condylar lesions and improved appearance. Compared with control group， the BV/TV and Tb.Th of the rats in model group were significantly decreased （P<0.05）， and Tb.Sp was significantly increased （P<0.05）； compared with model group， the BV/TV and Tb.Th of the rats in resveratrol group were significantly increased （P<0.05）， and the Tb.Sp was significantly decreased （P<0.05）. The HE staining results showed clear layers and orderly chondrocyte arrangement in condyle of the rats in control group； the rats in model group showed rough uneven surface， obvious defects， and typical TMJOA features； the rats in resveratrol group showed slightly rough surface with generally clear layers and orderly arranged cells. The toluidine blue staining results showed distinct blue-purple staining of chondrocytes in hypertrophic layer of the rats in control group； pale staining or even loss of staining in some areas of the rats in model group； and distinct and relatively uniform staining in hypertrophic layer of the rats in resveratrol group. The immunohistochemistry results showed that compared with control group， the expression levels of MMP-13， PI3K， p-Akt， and p-mTOR proteins in TMJ tissue of the rats in model group were significantly increased （P<0.05）， while the expression levels of SOX-9 and Sirt1 proteins in TMJ tissue of the rats were significantly decreased （P<0.05）； compared with model group， the expression levels of SOX-9 and Sirt1 proteins in TMJ tissue of the rats in resveratrol group were significantly increased （P<0.05）， whereas the expression levels of MMP-13， PI3K， p-Akt， and p-mTOR proteins were significantly decreased （P<0.05）.The RT-qPCR results showed that compared with control group， the expression levels of MMP-13， PI3K， Akt， and mTOR mRNA in TMJ tissue of the rats in model group were significantly increased （P<0.05）， while the expression levels of SOX-9 and Sirt1 mRNA were significantly decreased （P<0.05）； compared with model group， the expression levels of SOX-9 and Sirt1 mRNA in TMJ tissue of the rats in resveratrol group were significantly increased （P<0.05）， whereas the expression levels of MMP-13， PI3K， Akt， and mTOR mRNA were significantly decreased （P<0.05）. Conclusion Resveratrol has therapeutic effect on TMJOA， and its mechanism may be related to the activation of Sirt1 and inhibition of the PI3K-Akt-mTOR signaling pathway.

Key words: Resveratrol, Temporomandibular joint osteoarthritis, Silence information regulation 1, Phosphoinositide 3-kinase, Protein kinase B, Mammalian target of rapamycin

CLC Number:

R684.3

Gao SUN,Jing HE,Qi ZHAO,Jianhong SHI,Zhiling LIAO,Yuanye TIAN,Guomin WU. Therapeutic effect of resveratrol on osteoarthritis of temporomandibular joint and its mechanism[J].Journal of Jilin University(Medicine Edition), 2024, 50(6): 1547-1556.

Figures/Tables 10

Fig. 1

Tab.1

Fig. 2

Fig. 3

Tab.2

Fig. 4

Fig. 5

Fig. 6

Tab. 3

Tab.4

References 25

1	STOCUM D L， ROBERTS W E. Part Ⅰ： development and physiology of the temporomandibular joint［J］. Curr Osteoporos Rep， 2018， 16（4）： 360-368.
2	LEE W S， KIM H J， KIM K I， et al. Intra-articular injection of autologous adipose tissue-derived mesenchymal stem cells for the treatment of knee osteoarthritis： a phase Ⅱb， randomized， placebo-controlled clinical trial［J］. Stem Cells Transl Med， 2019， 8（6）： 504-511.
3	HAMERMAN D. The biology of osteoarthritis［J］. N Engl J Med， 1989， 320（20）： 1322-1330.
4	ZHAO Y， GAN Y H. Combination of hyperlipidemia and 17β-Estradiol induces TMJOA-like pathological changes in rats［J］. Oral Dis， 2023， 29（8）： 3640-3653.
5	STOUSTRUP P， Therapy TWILT M.. Intra-articular steroids for TMJ arthritis： caution needed［J］. Nat Rev Rheumatol， 2015， 11（10）： 566-567.
6	ENGLUND M， ROOS E M， LOHMANDER L S. Impact of type of meniscal tear on radiographic and symptomatic knee osteoarthritis： a sixteen-year followup of meniscectomy with matched controls［J］. Arthritis Rheum， 2003， 48（8）： 2178-2187.
7	ZHANG S P， YAP A U J， TOH W S. Stem cells for temporomandibular joint repair and regeneration［J］. Stem Cell Rev Rep， 2015， 11（5）： 728-742.
8	BIASUTTO L， MATTAREI A， AZZOLINI M， et al. Resveratrol derivatives as a pharmacological tool［J］. Ann N Y Acad Sci， 2017， 1403（1）： 27-37.
9	KURŠVIETIENĖ L， STANEVIČIENĖ I， MONGIRDIENĖ A， et al. Multiplicity of effects and health benefits of resveratrol［J］. Medicina， 2016， 52（3）： 148-155.
10	LIN T C， LIN J N， YANG I H， et al. The combination of resveratrol and Bletilla striata polysaccharide decreases inflammatory markers of early osteoarthritis knee and the preliminary results on LPS-induced OA rats［J］. Bioeng Transl Med， 2022， 8（4）： e10431.
11	LONG Z Y， XIANG W， LI J， et al. Exploring the mechanism of resveratrol in reducing the soft tissue damage of osteoarthritis based on network pharmacology and experimental pharmacology［J］. Evid Based Complementary Altern Med， 2021， 2021： 9931957.
12	ZHOU Z Q， DENG Z H， LIU Y W， et al. Protective effect of SIRT1 activator on the knee with osteoarthritis［J］. Front Physiol， 2021， 12： 661852.
13	YUCE P， HOSGOR H， RENCBER S F， et al. Effects of intra-articular resveratrol injections on cartilage destruction and synovial inflammation in experimental temporomandibular joint osteoarthritis［J］. J Oral Maxillofac Surg， 2021， 79（2）： 344.e1-344.e12.
14	IZAWA T， HUTAMI I R， TANAKA E. Potential role of rebamipide in osteoclast differentiation and mandibular condylar cartilage homeostasis［J］. Curr Rheumatol Rev， 2018， 14（1）： 62-69.
15	LEI J， HAN J H， LIU M Q， et al. Degenerative temporomandibular joint changes associated with recent-onset disc displacement without reduction in adolescents and young adults［J］. J Cranio Maxillo Facial Surg， 2017， 45（3）： 408-413.
16	YI H， ZHANG W， CUI Z M， et al. Resveratrol alleviates the interleukin-1β-induced chondrocytes injury through the NF-κB signaling pathway［J］. J Orthop Surg Res， 2020， 15（1）： 424.
17	LI M， YUAN Z P， YU F， et al. Microfluidic-based screening of resveratrol and drug-loading PLA/Gelatine nano-scaffold for the repair of cartilage defect［J］. Artif Cells Nanomed Biotechnol， 2018， 46（sup1）： 336-346.
18	褚云峰，于红燕，杨琪，等. 白藜芦醇在骨关节炎中的作用及机制研究进展［J］. 中国骨质疏松杂志， 2022， 28（9）： 1351-1355.
19	CORBI G， CONTI V， SCAPAGNINI G， et al. Role of sirtuins， calorie restriction and physical activity in aging［J］. Front Biosci （Elite Ed）， 2012， 4（2）： 768-778.
20	YACOUB R， LEE K， HE J C. The role of SIRT1 in diabetic kidney disease［J］. Front Endocrinol， 2014， 5： 166.
21	FENG K， CHEN Z X， LIU P C， et al. Quercetin attenuates oxidative stress-induced apoptosis via SIRT1/AMPK-mediated inhibition of ER stress in rat chondrocytes and prevents the progression of osteoarthritis in a rat model［J］. J Cell Physiol， 2019， 234（10）： 18192-18205.
22	XUE J F， SHI Z M， ZOU J， et al. Inhibition of PI3K/AKT/mTOR signaling pathway promotes autophagy of articular chondrocytes and attenuates inflammatory response in rats with osteoarthritis［J］. Biomed Pharmacother， 2017， 89： 1252-1261.
23	ZHANG Y， VASHEGHANI F， LI Y H， et al. Cartilage-specific deletion of mTOR upregulates autophagy and protects mice from osteoarthritis［J］. Ann Rheum Dis， 2015， 74（7）： 1432-1440.
24	XU Z R， HAN X， OU D M， et al. Targeting PI3K/AKT/mTOR-mediated autophagy for tumor therapy［J］. Appl Microbiol Biotechnol， 2020， 104（2）： 575-587.
25	MARIÑO G， MORSELLI E， BENNETZEN M V， et al. Longevity-relevant regulation of autophagy at the level of the acetylproteome［J］. Autophagy， 2011， 7（6）： 647-649.

Gene	Forward sequence（5'-3'）	Reverse sequence（5'-3'）
SOX-9	CACTACAGCGAGCAGCAGCAG	TGATGGTTGGGTAGGAGGGGTTG
MMP-13	CAGCCCTATCCCTTGATGCCATTAC	GGGTGCAGACGCCAGAAGAATC
Sirt1	ACGCCTTATCCICTAGTTCCTGTGG	CGGTCTGTCAGCATCATCTTCCAAG
PI3K	GCCTCAGTGGACTTGGATGTGTTC	GTCTTCGGAGCTTGGTACTTCTTGG
Akt	CGCTTCTTTGCCAACATCGT	ACACTCCATGCTGTCATCTTGA
mTOR	CATTCCGACCGCTGCCTTCAC	GACCTCACCGCCACAGAAAGC
GAPDH	AGTCTACTGECGTCTTCACC	CCACGATGCCAAAGTTGTCA

Group	BV/TV	Tb.Th （l/mm）	Tb.Sp （l/mm）	Tb.N （l/mm）
Control	0.68±0.05	0.14±0.02	0.10±0.02	7.02±1.67
Model	0.25±0.07^*	0.07±0.01^*	0.16±0.02^*	6.00±0.59
Resveratrol	0.59±0.06^△	0.11±0.02^△	0.10±0.02^△	7.75±0.21

Group	SOX-9	MMP-13	Sirt1	PI3K	p-Akt	p-mTOR
Control	0.23±0.02	0.18±0.01	0.32±0.01	0.20±0.02	0.17±0.03	0.16±0.01
Model	0.16±0.02^*	0.29±0.01^*	0.21±0.01^*	0.28±0.01^*	0.27±0.01^*	0.25±0.02^*
Resveratrol	0.20±0.01^△	0.22±0.01^△	0.27±0.01^△	0.22±0.01^△	0.18±0.03^△	0.16±0.02^△

Group	SOX-9	MMP-13	Sirt1	PI3K	Akt	mTOR
Control	1.00±0.04	1.00±0.05	1.01±0.18	1.01±0.19	1.01±0.20	1.00±0.12
Model	0.39±0.04^*	1.72±0.08^*	0.37±0.07^*	2.65±0.35^*	3.33±0.25^*	2.57±0.39^*
Resveratrol	0.57±0.07^△	1.54±0.06^△	0.91±0.08^△	1.63±0.15^△	1.48±0.25^△	1.26±0.34^△

[1]	Xiao LIU,Fei FEI,Tao LIU,Lan QIN. Relationship between serum PI3K and Akt levels and thrombocytopenia in patients with Sjögren’s syndrome and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 483-490.
[2]	Shanshan SUN,Mei LU,Xinfu GAO,LYu Guangyao,Baolei Zhao,LYu Wenwen. Inhibitory effect of Bradykinin 1 receptor antagonist ELN441958 on proliferation of HepG2 cells by regulating Akt/FoxO3a signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 70-80.
[3]	Bing BAI,Qian ZHANG,Tao PU,Yu NI,Tingting HU,Linhong HU,Yibin YANG. Effect of angiopoietin 1 and tyrosine kinase receptor 2 inhibitor on glucose transportation in endothelial cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1487-1497.
[4]	Haidong ZHU,Changkun LYU,Wei SHI. Effect of berberine hydrochloride on autophagy of HeLa cells infected with herpes simplex virus type 1 by regulating PI3K/AKT/mTOR signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1607-1617.
[5]	Wei AN, MAIMAITITUXUN·Tuerdi,Zhitao YAO. Regulatory effect of lutein on PI3K/AKT signaling pathway and chondrocyte autophagy in mandibular joint cartilage tissue of rabbits and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 976-983.
[6]	Cheng CHEN,Jingyao LI,Wanxiang HU,Donghui LIU,Zhihong CHEN. Protective effect of sericin on streptozotocin-induced INS-1 cell damage by regulating PI3K/Akt/NF-κB signaling pathway through Akt1 and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 590-598.
[7]	Yihui WANG,Qing ZHANG,Yingnan LI,Liping YE. Effect of KIAA1522 on proliferation, migration, and invasion of lung cancer cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 727-739.
[8]	Mengyun LU,Yucheng HAN,Yihong HU,Minhui HE,Yanqun ZHANG,Xianqiong ZOU. Effects of glycolipid transfer protein on proliferation, migration，and invasion of pancreatic cancer PANC-1 cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 284-295.
[9]	Ying YANG,Liang ZHAO,Yong YOU,Qian XU,Zhenjun YANG. Influence of 17β-estradiol in proliferation and differentiation of hippocampal neural stem cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 317-324.
[10]	Chaohe ZHANG,Xinwei ZHANG,Xiangfeng WANG. Protective effect of Pien-Tze-Huang on acetaminophen-induced liver injury and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(1): 105-114.
[11]	Min CHEN,Huiyan ZHU,Jing TAO,Yipeng XU. Ameliorating effect of betaine on oxygen-glucose deprivation injury in rat brain microvascular endothelial cells and its influence in PI3K/AKT pathway [J]. Journal of Jilin University(Medicine Edition), 2025, 51(1): 96-104.
[12]	Jing LOU,Lei ZHAO,Yanjie ZHU,Shuaiqiang YUAN,Fei WANG,Hangzhou ZHANG,Jiaojiao XU,Xiaoke YU,Liufa HOU. Effect of Fuzheng Ruanjian Anticancer Formula on malignant biological behaviors of hepatocellulars carcinoma HepG2 cells by regulating Akt/MDM2/P53 signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1654-1663.
[13]	Yutong WANG,Ruili RAN,Jiang BIAN,Xiaohan JIANG,Junqiu SONG,Dewei WANG,Jing YANG. Protective effect of carnosine against oxygen-glucose deprivation/reoxygenation-induced astrocyte injury through inhibition of autophagy by AMPK/mTOR signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2024, 50(5): 1297-1304.
[14]	Xueting CHI,Fangyuan CHEN,Zifeng PI,Guangfu LYU,Yuchen WANG,Yinqing LI,Xiaowei HUANG,Zhe LIN. Improvement effect of velvet antler polypeptide on postmenopausal osteoporosis in rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(4): 963-969.
[15]	Tengfei WANG, Feng CHEN, Ling QI, Ting LEI, Meihui SONG. Inhibitory effect of D-limonene on proliferation of glioblastoma cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(3): 647-657.

Therapeutic effect of resveratrol on osteoarthritis of temporomandibular joint and its mechanism

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 10

References 25

Related Articles 15

Metrics

Comments

Recommended 10