Journal of Jilin University(Medicine Edition) ›› 2021, Vol. 47 ›› Issue (2): 249-256.doi: 10.13481/j.1671-587X.20210201
• Research in basic medicine • Next Articles
Ye YUAN1,Jinbao ZHUANG1,Xu SHI1,Changyuan LI2(
)
Received:2020-09-09
Online:2021-03-28
Published:2021-03-25
Contact:
Changyuan LI
E-mail:lichangyuanjlu@163.com
CLC Number:
Ye YUAN,Jinbao ZHUANG,Xu SHI,Changyuan LI. Influence of PGE2 on PD-1 expression in infiltrating T lymphocytes in non-small cell lung cancer tissue and its mechanism[J].Journal of Jilin University(Medicine Edition), 2021, 47(2): 249-256.
Tab.1
Clinical parameters of NSCLC patients"
| Parameter | Stage Ⅰ (n=20) | Stage Ⅱ (n=25) | Stage Ⅲ (n=17) | Stage Ⅳ (n=13) |
|---|---|---|---|---|
TNM stage (number) | T1aN0M0 (11) T1bN0M0 (9) | T1bN1M0 (7) T2aN1M0 (10) T2bN0M0 (8) | T1N2M0 (6) T2N2M0 (6) T3N1M0 (5) | T2N2M1a (8) T3N2M1a (5) |
| Age (year) | 56 (42-63) | 58 (46-67) | 57 (44-65) | 56 (45-68) |
| Gender(Female/Male) | 14/6 | 17/8 | 12/5 | 9/4 |
Tab. 2
Primer sequences of target genes in RT-qPCR"
| Primer | Sequence (5'-3') |
|---|---|
PD-1 Forward Reverse | AAGCTTATGTGGGTCCGGC GGATCCTCAAAGAGGCC |
EP2 Forward Reverse | CCACGATGCTCCTGCTGCTT TCCACAAAGGTCAGTCTGTTT |
EP4 Forward Reverse | GGTCATCTTACTCATCGCCACCTCTC TCCCACTAACCTCATCCACCAACAG |
GAPDH Forward Reverse | GGTGGTCTCCTCTGACTTCAACA GTGGTCGTTGAGGGCAATG |
| 1 | 国家统计局. 中国统计年鉴2019 [M]. 北京: 中国统计出版社, 2019. |
| 2 | HERBST R S, MORGENSZTERN D, BOSHOFF C. The biology and management of non-small cell lung cancer [J]. Nature, 2018, 553(7689):446-454. |
| 3 | COMEN E A, BOWMAN R L, KLEPPE M. Underlying causes and therapeutic targeting of the inflammatory tumor microenvironment [J]. Front Cell Dev Biol, 2018, 6:56. |
| 4 | LIN E W, KARAKASHEVA T A, HICKS P D, et al. The tumor microenvironment in esophageal cancer [J]. Oncogene, 2016, 35(41):5337-5349. |
| 5 | TSUGE K, INAZUMI T, SHIMAMOTO A, et al. Molecular mechanisms underlying prostaglandin E2-exacerbated inflammation and immune diseases [J]. Int Immunol, 2019, 31(9):597-606. |
| 6 | MARTINEZ-COLÓN G J, MOORE B B. Prostaglandin E(2) as a regulator of immunity to pathogens [J]. Pharmacol Ther, 2018, 185:135-146. |
| 7 | ALSAAB H O, SAU S, ALZHRANI R, et al. PD-1 and PD-L1 checkpoint signaling inhibition for cancer immunotherapy: mechanism, combinations, and clinical outcome [J]. Front Pharmacol, 2017, 8:561. |
| 8 | DERMANI F K, SAMADI P, RAHMANI G, et al. PD-1/PD-L1 immune checkpoint: potential target for cancer therapy [J]. J Cell Physiol, 2019, 234(2):1313-1325. |
| 9 | LUEN S J, SAVAS P, FOX S B, et al. Tumour-infiltrating lymphocytes and the emerging role of immunotherapy in breast cancer [J]. Pathology, 2017, 49(2):141-155. |
| 10 | REISER J, BANERJEE A. Effector, memory, and dysfunctional CD8(+) T cell fates in the antitumor immune response [J]. J Immunol Res, 2016, 2016:8941260. |
| 11 | MCGRANAHAN N, SWANTON C. Clonal heterogeneity and tumor evolution: past, present, and the future [J]. Cell, 2017, 168(4):613-628. |
| 12 | BUCHAN S L, FALLATAH M, THIRDBOROUGH S M, et al. PD-1 blockade and CD27 stimulation activate distinct transcriptional programs that synergize for CD8(+) T-cell-driven antitumor immunity [J]. Clin Cancer Res, 2018, 24(10):2383-2394. |
| 13 | ARRIETA O, MONTES-SERVIN E, HERNANDEZ-MARTINEZ J M, et al. Expression of PD-1/PD-L1 and PD-L2 in peripheral T-cells from non-small cell lung cancer patients [J]. Oncotarget, 2017, 24;8(60):101994-102005. |
| 14 | MILDNER F, SOPPER S, AMANN A, et al. Systematic review: Soluble immunological biomarkers in advanced non-small-cell lung cancer (NSCLC) [J]. Crit Rev Oncol Hematol, 2020, 153:102948. |
| 15 | RAPHAEL I, NALAWADE S, EAGAR T N, et al. T cell subsets and their signature cytokines in autoimmune and inflammatory diseases [J]. Cytokine, 2015, 74(1):5-17. |
| 16 | PICCIRILLO C A. Transcriptional and translational control of Foxp3+ regulatory T cell functional adaptation to inflammation [J]. Curr Opin Immunol, 2020, 67:27-35. |
| 17 | CHEN J H, PERRY C J, TSUI Y C, et al. Prostaglandin E2 and programmed cell death 1 signaling coordinately impair CTL function and survival during chronic viral infection [J]. Nat Med, 2015, 21(4):327-334. |
| 18 | GORCHS L, FERNANDEZ MOREO C, BANKHEAD P, et al. Human pancreatic carcinoma-associated fibroblasts promote expression of co-inhibitory markers on CD4+ and CD8+T-Cells [J]. Front Immunol, 2019, 10:847. |
| 19 | PENG L, YE Y, MULLIKIN H, et al. Expression of trophoblast derived prostaglandin E2 receptor 2 (EP2) is reduced in patients with recurrent miscarriage and EP2 regulates cell proliferation and expression of inflammatory cytokines [J]. J Reproductive Immunol, 2020, 142:103210. |
| 20 | BRADBURY P, RUMZHUM N N, AMMIT A J. EP(2) and EP(4) receptor antagonists: Impact on cytokine production and β(2) -adrenergic receptor desensitization in human airway smooth muscle [J]. J Cell Physiol, 2019, 234(7):11070-11077. |
| [1] | Yuling GU,Cui ZHENG,Yunxian TANG. Inhibitory effect of silencing of circadian rhythm gene TIMELESS on immune escape of ovarian cancer SK-OV-3 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 653-662. |
| [2] | Xiaoyu HOU,Ya LI,Yian SONG,Tianhui HE,Jie ZHANG,Jianhui XU. Effect of prostaglandin E2 on discharge activity of warm-sensitive neurons in median preoptic nucleus of hypothalamus in female mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(1): 17-25. |
| [3] | Yuan WANG,Zhijuan WANG,Mingshu ZHANG,Yihui WANG,Qing ZHANG,Liping YE. Effects of monocyte chemoattractant protein-1 on invasion and migration of lung cancer A549 and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2024, 50(3): 666-675. |
| [4] | Aihua REN,Yanbo DONG,Runzhi MIAO,Yujiao LYU,Yanfeng LIU. Effect of ganoderic acid A on glycolysis and its key rate-limiting enzymes of non-small cell lung cancer PC9 cells [J]. Journal of Jilin University(Medicine Edition), 2024, 50(3): 682-688. |
| [5] | Zongjun CHEN,Yahong CHEN,Liyun HUANG,Ziying LIANG. Effects of genomic instability and MYC gene mutation of non-small cell lung cancer A549 cells on resistance of gemcitabine [J]. Journal of Jilin University(Medicine Edition), 2024, 50(2): 355-363. |
| [6] | Bo HUANG,Jie DING,Hongrong GUO,Hongjuan WANG,Jianqun XU,Quan ZHENG. Effects of HIF-1α/ROS on apoptosis and invasion of lung cancer A549 cells under hypoxia and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 682-690. |
| [7] | Wenli JIANG,Lin ZHANG,Junyao LI,Mingyu XU,Jie ZHANG,Chunling DONG. Targeted therapy of osimertinib combined with savolitinib in NSCLC with EGFR-TKI resistance complicated with MET amplification: A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 782-788. |
| [8] | Yunpeng LIU,Zihao LIU,Boming KANG,Zhiguang YANG. Regulatory effect of lncRNA SNHG17 on biological behavior of non-small cell lung cancer cells by targeting AEG1 through miR-384 [J]. Journal of Jilin University(Medicine Edition), 2023, 49(2): 298-307. |
| [9] | Yang BAI,Chenxi YANG,Xiaoqiang LIU,Yu LIU,Qian XING. Changes of follicular helper T lymphocytes in peripheral blood of patients with systemic lupus erythematosus during pregnancy and its significance [J]. Journal of Jilin University(Medicine Edition), 2023, 49(1): 166-172. |
| [10] | Jilin FAN,Tingting ZHU,Xiaoling TIAN,Sijia LIU,Jing SU,Shiliang ZHANG. Bioinformatics analysis based on circRNA-miRNA-mRNA network construction and immune cell infiltration in atrial fibrillation [J]. Journal of Jilin University(Medicine Edition), 2022, 48(6): 1535-1545. |
| [11] | Junjie HOU,Xuguang MI,Xiaonan LI,Xiaonan LI,Ying YANG,Xianzhuo JIANG,Ying ZHOU,Zhiqiang NI,Ningyi JIN,Yanqiu FANG. Bronchopleural fistula complicated in treatment process of non-small cell lung cancer by bevacizumab combined with paclitaxel: A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2022, 48(2): 513-517. |
| [12] | Guangcai WAN,Hongshuai SUN,Hua ZHU,Xiuyan YU. Meta-analysis on relationship between neutrophil/lymphocyte ratio and prognosis of patients with non-small cell lung cancer treated with EGFR-TKIs [J]. Journal of Jilin University(Medicine Edition), 2020, 46(6): 1267-1273. |
| [13] | WANG Tianyue, ZHOU Qianlan, SHANG Yunxiao. Effect of epigallocatechin-3-gallate on airway inflammation and Treg/Th17 immune balance of mice with obese asthma [J]. Journal of Jilin University(Medicine Edition), 2019, 45(03): 491-497. |
| [14] | WANG Zhijing, SU Rongjian, DU Xiaoyuan. Effects of GRP78 on sensibility of gemcitabine on patients with NSCLC [J]. Journal of Jilin University(Medicine Edition), 2019, 45(03): 595-600. |
| [15] | LI Lijing, ZANG Yaru, YU Wenhui, LIANG Junwei, TONG Yanjun. Therapeutic effect of chemotherapy combined with sodium cantharidinate vitamin B6 injection in patientswith non-small cell lung cancer and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2018, 44(06): 1286-1290. |