结肠癌组织中miR-1915-3p和Bcl-2的表达及其临床意义

doi:10.13481/j.1671-587X.20210226

Abstract

Abstract:

Objective： To investigate the expressions of miR-1915-3p and Bcl-2 mRNA in colon cancer tissue and their relationships with the clinicopathological parameters and prognosis of the colon cancer patients， and to clarify the roles of miR-1915-3p and Bcl-2 in the occurrence and development of colon cancer.

Methods

A total of 40 colon cancer specimens and paired paracancer normal mucosa tissue were collected for examination of miR-1915-3p and Bcl-2 mRNA expression levels by Real-time fluorescence quantitative polymerase chain reaction （RT-qPCR）. The correlation between the miR-1915-3p expression level and Bcl-2 mRNA expression level was analyzed by Pearson correlation analysis. The correlations between the expressions of miR-1915-3p and Bcl-2 and the clinicopathological features and prognosis of the colon cancer patients were analyzed by χ² test. The survival curve was drawn by Kaplan-Meier method， and the survival difference was tested by Log-rank test.

Results

The RT-qPCR results showed that compared with the adjacent mucosa tissue， the expression level of miR-1915-3p in colorn cancer tissue was decreased significantly （P<0.05）， and the expression level of Bcl-2 mRNA in colon cancer tissue was increased （P<0.05）； there was a significant negative correlation between the expression level of miR-1915-3p and the expression level of Bcl-2 mRNA in colon cancer tissue （r=－0.542，P<0.05）. The expression lervels of miR-1915-3p in colon cancer tissue was significantly correlated with the degree of tumor differentiation and lymph node metastasis （P<0.05）， but not with gender， age， tumor size and TNM stage （P>0.05）. The expression level of Bcl-2 mRNA in colon cancer tissue was significantly correlated with TNM stage （P<0.05）， but was not related to other clinicopathological features （P>0.05）. The Kaplan-Meier analysis results of survival curve showed that the overall survival（OS） of the colon cancer patients in miR -1915-3p high expression group was lower than that in miR-1915-3p low expression group （χ²=3.641，P<0.05）. There was no significant relationship between the expression level of Bcl-2 mRNA and the prognosis of colon cancer patients （χ²=0.571，P>0.05）.

Conclusion

The miR-1915-3p expression level in tumor tissue of the colorectal cancer patients is decreased， but the expression level of Bcl-2 mRNA is significantly increased. The combined detection of them is useful for the diagnosis and prognosis evaluation of colon cancer.

Key words: colon neoplasms, miR-1915-3p, B cell lymphoma-2, survival analysis, overall survival

CLC Number:

R735.34

Weili HUANG,Yongchen LYU. Expressions of miR-1915-3p and Bcl-2 in human colon cancer and their clinical significances[J].Journal of Jilin University(Medicine Edition), 2021, 47(2): 453-459.

Figures/Tables 4

Tab.1

Fig.1

Tab.2

Fig. 2

References 20

1	BATTAGLIN F， NASEEM M， LENZ H J， et al. Microsatellite instability in colorectal cancer： overview of its clinical significance and novel perspectives ［J］. Clin Adv Hematol Oncol， 2018， 16（11）：735-745.
2	MÁRMOL I， SÁNCHEZ-DE-DIEGO C， PRADILLA DIESTE A， et al. Colorectal carcinoma： A general overview and future perspectives in colorectal cancer ［J］. Int J Mol Sci， 2017， 18（1）： 197.
3	DURAN-SANCHON S， MORENO L， AUGÉ J M， et al. Identification and validation of microRNA profiles in fecal samples for detection of colorectal cancer［J］. Gastroenterology， 2020， 158（4）：947-957.e4.
4	WAN Y， CUI R， GU J， et al. Identification of four oxidative stress-responsive microRNAs， miR-34a-5p， miR-1915-3p， miR-638， and miR-150-3p， in hepatocellular Carcinoma ［J］. Oxidative Med Cell Longev， 2017， 2017：1-12.
5	CUI H W， HAN W Y， HOU L N， et al. miR-1915-3p inhibits Bcl-2 expression in the development of gastric cancer ［J］. Biosci Rep，2019.DOI：10.1042/bsr20182321. doi: 10.1042/bsr20182321
6	KHODAPASAND E， JAFARZADEH N， FARROKHI F， et al. Is Bax/Bcl-2 ratio considered as a prognostic marker with age and tumor location in colorectal cancer？［J］. Iran Biomed J， 2015， 19（2）：69-75.
7	JUNG G， Hernández-Illán E， MOREIRA L， et al. Epigenetics of colorectal cancer： biomarker and therapeutic potential［J］. Nat Rev Gastroenterol Hepatol， 2020， 17（2）：111-130.
8	WEN J， HALL B， SHI X. A network view of microRNA and gene interactions in different pathological stages of colon cancer ［J］. BMC Med Genomics， 2019， 12（S7）：158.
9	SU J，LI J，YU Q，et al. Exosomal miRNAs as potential biomarkers for acute myocardial infarction［J］. IUBMB Life， 2020， 72（3）：384-400.
10	GUO J， LIU C， WANG W， et al. Identification of serum miR-1915-3p and miR-455-3p as biomarkers for breast cancer ［J］. PLoS One， 2018， 13（7）：e0200716.
11	GAO J， GAO L， LI R X， et al. Integrated analysis of microRNA-mRNA expression in A549 cells infected with influenza A viruses （IAVs） from different host species［J］. Virus Res， 2018， 263：34-46.
12	NAKAZAWA K， DASHZEVEG N， YOSHIDA K. Tumor suppressor p53 induces miR-1915 processing to inhibit Bcl-2 in the apoptotic response to DNA damage ［J］. FEBS J， 2014， 281（13）： 2937-2944.
13	SALLUSTIO F， SERINO G， COSTANTINO V， et al.miR-1915 and miR-1225-5p regulate the expression of CD133， PAX2 and TLR2 in adult renal progenitor cells［J］. PLoS One， 2013， 8（7）：e68296.
14	ROOSWINKEL R W， DE KOOIJ BVAN， DE VRIES E， et al. Antiapoptotic potency of Bcl-2 proteins primarily relies on their stability， not binding selectivity ［J］. Blood， 2014， 123（18）： 2806-2815.
15	KLASA R J， GILLUM A M， KLEM R E， et al. Oblimersen Bcl-2 antisense： facilitating apoptosis in anticancer treatment ［J］. Antisense Nucleic Acid Drug Dev， 2002， 12（3）：193-213.
16	RYAN C E， DAVIDS M S. BCL-2 inhibitors， present and future ［J］. Cancer J， 2019， 25（6）：401-409.
17	BADR E A，ASSAR M F，ELTORGOMAN A M A， et al. A correlation between BCL-2 modifying factor， p53 and livin gene expressions in colon cancer patients［J］. Biochem Biophys Rep， 2020， 22：100747.
18	MELINCOVICI C S，MIHU C M， MĂRGINEAN M， et al. The prognostic significance of p53， Bax， Bcl-2 and cyclin E protein overexpression in colon cancer－an immunohistochemical study using the tissue microarray technique［J］. Rom J Morphol Embryol， 2016， 57（1）：81-89.
19	HUANG C C， WU D W， LIN P L， et al. Paxillin promotes colorectal tumor invasion and poor patient outcomes via ERK-mediated stabilization of Bcl-2 protein by phosphorylation at Serine 87［J］. Oncotarget， 2015， 6（11）：8698-8708.
20	ROSATI G， CHIACCHIO R， REGGIARDO G， et al. Thymidylate synthase expression， p53， bcl-2， Ki-67 and p27 in colorectal cancer： relationships with tumor recurrence and survival［J］. Tumor Biol， 2004， 25（5/6）：258-263.

Primer	Sequence (5'－3')
miR-1915-3p-RT	GCACTTCAGTGTCGTGGTCAGTGACGGC- AATTGAAGTGCCCCGCCGC
miR-1915-3p	F:CAGACGACCATCAGCCCCAGGGCGA
	R:CGCGGATCCATGTCTATTATTACAG
U6	F:GCTTCGGCAGCACATATACTAAAAT
	R:CGCTTCACGAATTTGCGTGTCAT
Bcl-2	F:AGTGGGATGCGGGAGATGT
	R:CGGGCTGGGAGGAGAAGA
GAPDH	F:CATTCAAGACCGGACAGAGG
	R:ACATACTCAGCACCAGCATCACC

Clinicopathological feature	n	miR-1915-3p		χ²	P	Bcl-2		χ²	P
Clinicopathological feature	n	Low	High	χ²	P	Low	High	χ²	P
Gender				0.001	0.972			0.029	0.864
Male	26	17	9			9	17
Female	14	10	4			6	8
Age (year)				1.819	0.177			0.006	0.936
<60	23	18	5			4	19
≥60	17	9	8			4	13
Tumor size(l/cm)				0.459	0.498			0.001	0.974
<5	12	7	5			6	6
≥5	28	21	7			9	12
Degree of differentiation				6.567	0.038			0.688	0.709
Low differentiation	11	11	0			4	7
Moderate differentiation	16	14	2			5	11
High differentiation	13	8	5			6	7
Lymph node metastasis				5.260	0.022			3.472	0.062
Yes	24	23	1			3	21
No	16	10	6			7	9
TNM stage				1.284	0.257			4.167	0.041
Ⅰ-Ⅱ	15	8	7			6	9
Ⅲ-Ⅳ	25	19	6			2	23

[1]	Jing DENG,Xuan WANG,Changyu SHI,Siqi YANG,Qinling ZOU,Ming JIN. Effect of securinine on proliferation and apoptosis of human colon cancer SW620 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 307-316.
[2]	Bo LIU,Chao SUN,Xu WANG,Kewei MA. Bioinformatics analysis on differentially expressed genes in multiple primary lung cancers based on GEO database [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 437-446.
[3]	Yuanguo WANG,Peng ZHANG. Bioinformatics analysis based on relationship between SSP1 and TGFB1 and occurrence, prognosis, and immune invasion of esophageal adenocarcinoma [J]. Journal of Jilin University(Medicine Edition), 2024, 50(4): 1076-1086.
[4]	Xueru HUANG,Xuhao DING,Suxian CHEN,Qi TAN,Yueming WU,Xiaomin NIU,Yadi WANG,Qing TONG. Effect of PMS2 on biological behaviors of colon cancer SW480 cells through ERK/ERCC1 pathway [J]. Journal of Jilin University(Medicine Edition), 2023, 49(4): 931-940.
[5]	Nannan HU,Fuxu YANG,Yeteng MU,Chong GUO,Han XUE,Yuxin FAN,Fenglin GUO,Xingang GUAN. Preparation of oxaliplatin-loaded elastin-like polypeptides hydrogel and its killing effect on colon cancer CT26 cells [J]. Journal of Jilin University(Medicine Edition), 2023, 49(1): 94-100.
[6]	Yingjie NIU,Yong ZHA,Sijia LI,Qing WANG,Shicong TANG,Hongyang LI. Analysis on prognosis related factors of patients with cholangiocarcinoma after radical resection and establishment of survival prediction model [J]. Journal of Jilin University(Medicine Edition), 2022, 48(4): 979-987.
[7]	Qian LIU,Guoping QI,Huayi YU,Yuyang DAI,Wenbin LU,Jianhua JIN. Bioinformatics analysis on screening of colon cancer core genes and independent prognostic factors [J]. Journal of Jilin University(Medicine Edition), 2022, 48(3): 755-765.
[8]	Shan GAO,Yutong WANG,Minqiu LU,Lei SHI,Bin CHU,Yuehua DING,Mengzhen WANG,Li BAO. Analysis on causes for early death and its risk factors of patients with multiple myeloma in era of novel drugs [J]. Journal of Jilin University(Medicine Edition), 2022, 48(3): 783-789.
[9]	Suxian CHEN,Zehui GU,Yangfei MA,Qi TAN,Qi LI,Yadi WANG. Promotion effect of rutin on apoptosis of human colon cancer SW480 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(2): 356-363.
[10]	Yang YU,Sainan LIU,Yunkai LIU,Yong LI,Yichun QIAO,Yi CHENG. Bioinformatic analysis on expression characteristics of PRPS2 and its relationship with prognosis of breast cancer [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1229-1236.
[11]	Bo MA, Jiangang LI, Jun WANG, Junli HOU, Liang LI. Promotion effect of miR-106b on invasion and migration of colon cancer cells through targeting TGF-β/Smad pathway [J]. Journal of Jilin University(Medicine Edition), 2021, 47(3): 630-636.
[12]	YAN Shengyu, XIE Yafeng, XU Zhijie, LIU Ying, DING Yating, ZHANG Qiao, LIU Wanying, LIU Libing. Inhibitory effect of antimicrobial peptide LL-37 on tumorgrowth of mice with colon cancer and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2020, 46(03): 575-581.
[13]	FENG Jie, REN Liqun, CHEN Suxian, WAN Yizeng, XU Peibin. Inhibitory effects of cucurbitacin B combined with oxaliplatin on proliferation and apoptosis of human colon cancer SW480 cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2020, 46(01): 78-83.
[14]	LI Hua, CAO Yansha, ZHAO Jinping, REN Fu, LI Ning. Expression of SIRT6 protein in colon cancer tissue detected by tissue microarray technique and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2019, 45(04): 893-898.
[15]	ZHOU Liuxiang, LIN Lin, HU Xinmin, WANG Xiaochun. Promotion effect of endocrine gland-derived vascular endothelial growth factor on proliferation and migration of colon cancer LoVo cells [J]. Journal of Jilin University Medicine Edition, 2018, 44(03): 516-520.

Expressions of miR-1915-3p and Bcl-2 in human colon cancer and their clinical significances

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 4

References 20

Related Articles 15

Metrics

Comments

Recommended 10