Journal of Jilin University(Medicine Edition) ›› 2022, Vol. 48 ›› Issue (4): 954-961.doi: 10.13481/j.1671-587X.20220415
• Research in basic medicine • Previous Articles Next Articles
Xinying ZOU,Shuang GAO,Hong ZHAO,Xin LIU,Yuanhang ZHAO,Jiazhuo SONG,Linlin YAN,Zhimin ZHANG(
)
Received:2021-10-26
Online:2022-07-28
Published:2022-07-26
Contact:
Zhimin ZHANG
E-mail:zhangzhim@jlu.edu.cn
CLC Number:
Xinying ZOU,Shuang GAO,Hong ZHAO,Xin LIU,Yuanhang ZHAO,Jiazhuo SONG,Linlin YAN,Zhimin ZHANG. Effect of TGF-β3-loaded methacrylated heparin on osteogenic differentiation of dental pulp stem cells and its mechanism[J].Journal of Jilin University(Medicine Edition), 2022, 48(4): 954-961.
Tab.1
Primer sequences for RT-qPCR"
| Gene | Forward primer (5'-3') | Reverse primer (5'-3') |
|---|---|---|
| ALP | TGGGGATTATCCTGTGCTCT | GCTGTCACTGGGGTCTTCAT |
| OPN | TGCCTGGAGAGGAGCAGAACT | GGCGCTACCTGTATCAATGGC |
| COL-Ⅰ | GGTACACGCAGGTCTCACCAGT | CCTGAGCCAGCAGATCGAGAA |
| Runx2 | TGCTTTGGTCTTGAAATCACA | TCTTAGAACAAATTCTGCCCTTF |
| GAPDH | GCACCGTCAAGGCTGAGAAC | ATGGTGGTGAAGACGCCAGT |
| 1 | ADAMIČKA M, ADAMIČKOVÁ A, DANIŠOVIČ L,et al. Pharmacological approaches and regeneration of bone defects with dental pulp stem cells[J]. Stem Cells Int, 2021, 2021: 4593322. |
| 2 | KHARE D, BASU B, DUBEY A K. Electrical stimulation and piezoelectric biomaterials for bone tissue engineering applications[J]. Biomaterials, 2020, 258: 120280. |
| 3 | DU X Y, FU S Y, ZHU Y F. 3D printing of ceramic-based scaffolds for bone tissue engineering: an overview[J]. J Mater Chem B, 2018,6(27): 4397-4412. |
| 4 | GHASSEMI T, SHAHROODI A, EBRAHIMZADEH M H,et al. Current concepts in scaffolding for bone tissue engineering[J]. Arch Bone Jt Surg, 2018, 6(2): 90-99. |
| 5 | GRONTHOS S, MANKANI M, BRAHIM J, et al. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo [J]. Proc Natl Acad Sci U S A, 2000, 97(25): 13625-13630. |
| 6 | SUI B D, WU D, XIANG L, et al. Dental pulp stem cells: from discovery to clinical application[J]. J Endod, 2020, 46(9S): S46-S55. |
| 7 | LIN J J, WANG L, LIN J H, et al. Dual delivery of TGF-β3 and ghrelin in microsphere/hydrogel systems for cartilage regeneration[J].Molecules,2021,26(19):5732. |
| 8 | PENG Y F, TELLIER L E, TEMENOFF J S. Heparin-based hydrogels with tunable sulfation & degradation for anti-inflammatory small molecule delivery[J]. Biomater Sci, 2016, 4(9): 1371-1380. |
| 9 | HE C, JI H F, QIAN Y H, et al. Heparin-based and heparin-inspired hydrogels: size-effect, gelation and biomedical applications[J]. J Mater Chem B, 2019,7(8): 1186-1208. |
| 10 | GOLUBOVSKY J L, EJIKEME T, WINKELMAN R,et al. Osteobiologics[J].Oper Neurosurg, 2021,21(): S2-S9. |
| 11 | GARCÍA-GARETA E, COATHUP M J, BLUNN G W.Osteoinduction of bone grafting materials for bone repair and regeneration[J]. Bone, 2015, 81: 112-121. |
| 12 | NOORI A, ASHRAFI S J, VAEZ-GHAEMI R, et al. A review of fibrin and fibrin composites for bone tissue engineering[J].Int J Nanomedicine,2017,12:4937-4961. |
| 13 | LEE Y C, CHAN Y H, HSIEH S C, et al. Comparing the osteogenic potentials and bone regeneration capacities of bone marrow and dental pulp mesenchymal stem cells in a rabbit calvarial bone defect model[J]. Int J Mol Sci, 2019, 20(20): E5015. |
| 14 | ANITUA E, TROYA M, ZALDUENDO M. Progress in the use of dental pulp stem cells in regenerative medicine[J]. Cytotherapy, 2018, 20(4): 479-498. |
| 15 | MORIKAWA M, DERYNCK R, MIYAZONO K. TGF-β and the TGF-β family: context-dependent roles in cell and tissue physiology[J]. Cold Spring Harb Perspect Biol, 2016, 8(5): a021873. |
| 16 | LICHTMAN M K, OTERO-VINAS M, FALANGA V.Transforming growth factor beta (TGF-β) isoforms in wound healing and fibrosis[J].Wound Repair Regen,2016,24(2):215-222. |
| 17 | KOMAI T, OKAMURA T, INOUE M, et al. Reevaluation of pluripotent cytokine TGF-β3 in immunity[J]. Int J Mol Sci, 2018, 19(8): E2261. |
| 18 | LI Y F, QIAO Z F, YU F L, et al. Transforming growth factor-β3/chitosan sponge (TGF-β3/CS) facilitates osteogenic differentiation of human periodontal ligament stem cells[J].Int J Mol Sci,2019,20(20): E4982. |
| 19 | KIM M, KIM S E, KANG S S, et al. The use of de-differentiated chondrocytes delivered by a heparin-based hydrogel to regenerate cartilage in partial-thickness defects[J]. Biomaterials, 2011, 32(31): 7883-7896. |
| 20 | HSU F M, HU M H, JIANG Y S, et al. Antibacterial polypeptide/heparin composite hydrogels carrying growth factor for wound healing[J]. Mater Sci Eng C Mater Biol Appl, 2020, 112: 110923. |
| [1] | Jing LIU,Yan WANG,Xu HUANG. Promoting effect of overexpressed circRNAs-modified dental pulp stem cell-derived exosomes on angiogenesis of human umbilical vein endothelial cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1561-1570. |
| [2] | Yaqi ZHANG,Jing MI,Jingrong YANG,Xinming LI,Li LI. Effect of up-regulation of miR-31 expression on osteogenic differentiation of dental pulp stem cells through Wnt-β/catenin signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 412-419. |
| [3] | Yingqun NI,Mao YANG,Di YANG,Chenglin GUO,Wenjun ZHU,Yaqin YU,Qin LU,Jinzhi LUO,Chunqin WU,Zhaohui FANG. Screening of key differentially expressed genes involved in osteogenic differentiation of lower limb vascular smooth muscle cells and validation [J]. Journal of Jilin University(Medicine Edition), 2024, 50(3): 620-627. |
| [4] | Xia DONG,Xunxia WANG,Fang YANG. Promotion effect of miR-34a on osteogenic differentiation of human periodontal ligament stem cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(6): 1362-1370. |
| [5] | Xuanchen LIU,Xiaoying TIE,Yulin LIU, WangNing. Effect of polygonum multiflorum extract on osteoporosis and differentiation of bone marrow mesenchymal stem cells in agravic mice [J]. Journal of Jilin University(Medicine Edition), 2021, 47(6): 1386-1396. |
| [6] | GUO Weiwei, QIN Yue, YANG Haibo, MI Zhanhu. Promotion effect of LncRNA MALAT1 on osteogenic differentiation of adipose-derived mesenchymal stem cells through miR-34c/SATB2 axis [J]. Journal of Jilin University(Medicine Edition), 2020, 46(05): 963-971. |
| [7] | BI Xueting, SHEN Yuqin, XU Xiaowei, LI Wenjie, WANG Zhuoran, LIN Chongtao. Effects of oligodeoxynucleotide YW002 on proliferation, cell cycle, apoptosis and early osteogenic differentiation of human periodontal ligament stem cells [J]. Journal of Jilin University(Medicine Edition), 2019, 45(02): 273-279. |
| [8] | CHEN Biao, ZHANG Rui, ZHANG Wenjuan, YUE Lei, FAN Xuhui, LIU Jilun, LIU Yaoqiang, CUI Yi, QU Pengfei, YANG Wei. Repair effect of dental pulp stem cells on facial nerve injury in rabbits and its mechanism [J]. Journal of Jilin University Medicine Edition, 2018, 44(03): 504-509. |
| [9] | YUAN Jing, CHEN Yaoyu, ZHAO Yifan, LIU Xiaobo, LIU Pengfei, ZHAO Lei. Promotive effect of SOX2 on neural differentiation of dental pulp stem cells and its significance [J]. Journal of Jilin University Medicine Edition, 2016, 42(06): 1076-1080. |
| [10] | FENG Wenlei, ZHANG Meng, XU Fangjie, YIN Shuanghong, WANG Yanjie, CHEN Xueling, WU Xiangwei. Effects of endothelial progenitor cells conditioned medium on proliferation and osteogenic differentiation of mesenchymal stem cells and their mechanisms [J]. Journal of Jilin University Medicine Edition, 2015, 41(02): 218-224. |
| [11] | ZHANG Lu, YIN Zhan-Hai, SHI Hua-Tao. Construction of pLenti6/V5-DEST-TAZ |vector and its effect  |on differentiation of MC3T3-E1 preosteoblasts [J]. J4, 2010, 36(3): 429-433. |
| [12] | YU Na, HE Fei, TAN Ying-hui. Effects of rhBMP2 on differentiation of human dental pulp stem cells and expression of Delta protein in vitro [J]. J4, 2009, 35(2): 330-333. |
|