Journal of Jilin University(Medicine Edition) ›› 2026, Vol. 52 ›› Issue (2): 299-307.doi: 10.13481/j.1671-587X.20260201
• Research in basic medicine • Next Articles
Zhenya DONG1,Xinge ZHANG,Yaya DENG,Jingling ZHU1,Huiling JIAN2(
),Yunhua ZHANG1(
)
Received:2025-07-05
Accepted:2025-09-02
Online:2026-03-28
Published:2026-04-15
Contact:
Huiling JIAN,Yunhua ZHANG
E-mail:1521003011@qq.com;yunhuazhang@shzu.edu.cn
CLC Number:
Zhenya DONG,Xinge ZHANG,Yaya DENG,Jingling ZHU,Huiling JIAN,Yunhua ZHANG. Effect of Furin expression regulated by specific protein 1 on asprosin secretion in adipocytes and its mechanism[J].Journal of Jilin University(Medicine Edition), 2026, 52(2): 299-307.
Tab.1
Primer sequences of RT-qPCR"
| Gene | Sequences (5'-3') | NCBI refsequence |
|---|---|---|
| FBN1 | F: GAGTTGGGGCAGAGACTGT | NM_007993.2 |
| R: TCCCTGCCTGTCTGGACTA | ||
| Furin | F: ATTCGTATGGCTACGGGCTG | NM_001081454.2 |
| R: TTTGCCGATGTCCTTGGGTT | ||
| SP1 | F: GCCACCATGAGCGACCAAGA | NM_013672.2 |
| R: GAGTCTGAGAAAAGGCGGCA | ||
| β-actin | F: GGCTGTATTCCCCTCCATCG | NM_007393.5 |
| R: CCAGTTGGTAACAATGCCATGT |
| [1] | GURIA S, HOORY A, DAS S, et al. Adipose tissue macrophages and their role in obesity-associated insulin resistance: an overview of the complex dynamics at play[J]. Biosci Rep, 2023, 43(3): BSR20220200. |
| [2] | UGUR K, ERMAN F, TURKOGLU S, et al. Asprosin, visfatin and subfatin as new biomarkers of obesity and metabolic syndrome[J]. Eur Rev Med Pharmacol Sci, 2022, 26(6): 2124-2133. |
| [3] | ROMERE C, DUERRSCHMID C, BOURNAT J, et al. Asprosin, a fasting-induced glucogenic protein hormone[J]. Cell, 2016, 165(3): 566-579. |
| [4] | COPPOLA I, BROUWERS B, MEULEMANS S, et al. Differential effects of furin deficiency on insulin receptor processing and glucose control in liver and pancreatic β cells of mice[J]. Int J Mol Sci, 2021, 22(12): 6344. |
| [5] | FERRERO R, RAINER P, DEPLANCKE B. Toward a consensus view of mammalian adipocyte stem and progenitor cell heterogeneity[J]. Trends Cell Biol, 2020, 30(12): 937-950. |
| [6] | LIU X, LU J C, NI X Y, et al. FASN promotes lipid metabolism and progression in colorectal cancer via the SP1/PLA2G4B axis[J]. Cell Death Discov, 2025, 11(1): 122. |
| [7] | ZHOU J Q, LIN L, CAI H, et al. SP1 impacts the primordial to primary follicle transition by regulating cholesterol metabolism in granulosa cells[J]. FASEB J, 2023, 37(2): e22767. |
| [8] | FENG P, CHE Y, GAO C Y, et al. Profibrotic role of transcription factor SP1 in cross-talk between fibroblasts and M2 macrophages[J]. iScience, 2023, 26(12): 108484. |
| [9] | CHEN H, SUN L J, FENG L, et al. Intermittent fasting promotes type 3 innate lymphoid cells secreting IL-22 contributing to the beigeing of white adipose tissue[J]. eLife, 2024, 12: RP91060. |
| [10] | ZHANG Y H, ZHU Z M, SUN L J, et al. Hepatic G protein-coupled receptor 180 deficiency ameliorates high fat diet-induced lipid accumulation via the Gi-PKA-SREBP pathway[J]. Nutrients, 2023, 15(8): 1838. |
| [11] | ZHU Z M, YANG Y X, SUN L J, et al. GPR180 reduces adiposity by inhibiting lipogenesis and fatty acid uptake in adipocytes[J]. Am J Physiol Endocrinol Metab, 2025, 328(3): E410-E419. |
| [12] | LIANG Y, LUO C, SUN L J, et al. Reduction of specific enterocytes from loss of intestinal LGR4 improves lipid metabolism in mice[J]. Nat Commun, 2024, 15(1): 4393. |
| [13] | SHI S, WANG J C, GONG H, et al. PGC-1α- coordinated hypothalamic antioxidant defense is linked to SP1-LanCL1 axis during high-fat-diet-induced obesity in male mice[J]. Antioxidants, 2024, 13(2): 252. |
| [14] | BROUWERS B, COPPOLA I, VINTS K, et al. Loss of Furin in β-cells induces an mTORC1-ATF4 anabolic pathway that leads to β-cell dysfunction[J]. Diabetes, 2021, 70(2): 492-503. |
| [15] | HONG T, LI J Y, WANG Y D, et al. High serum asprosin levels are associated with presence of metabolic syndrome[J]. Int J Endocrinol, 2021, 2021: 6622129. |
| [16] | JIANG J F, ZHOU Z Y, LIU Y Z, et al. Role of Sp1 in atherosclerosis[J]. Mol Biol Rep, 2022, 49(10): 9893-9902. |
| [17] | WICHAIYO S, KOONYOSYING P, MORALES N P. Functional roles of furin in cardio-cerebrovascular diseases[J]. ACS Pharmacol Transl Sci, 2024, 7(3): 570-585. |
| [18] | YOU M, LIU Y S, WANG B W, et al. Asprosin induces vascular endothelial-to-mesenchymal transition in diabetic lower extremity peripheral artery disease[J]. Cardiovasc Diabetol, 2022, 21(1): 25. |
| [19] | SUMMERS K M, BUSH S J, DAVIS M R, et al. Fibrillin-1 and asprosin, novel players in metabolic syndrome[J]. Mol Genet Metab, 2023, 138(1): 106979. |
| [20] | QUAN C, ZHU S S, WANG R Z, et al. Impaired SERCA2a phosphorylation causes diabetic cardiomyopathy through impinging on cardiac contractility and precursor protein processing[J]. Life Metab, 2022, 1(1): 54-66. |
| [21] | MADHOUN AAL, MOHAMMAD A, ABU-FARHA M, et al. FURIN R81C variant: a link to type 2 diabetes via impaired enzymatic activity[J]. Am J Physiol Endocrinol Metab, 2025, 329(1): E179-E189. |
| [1] | Di QIN,Lihong HUAGN,Qingshuang ZHENG,Jingjing SUN,Weimin XU. Analysis on correlation between serum pro-inflammatory cytokines and muscle mass in elderly patients with sarcopenic obesity and diabetes [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1293-1302. |
| [2] | Qi WANG,Lingyu JIANG,Xiangrong LIU. Research progress in application of weight-adjusted waist circumference index in risk prediction and evaluation of obesity-related diseases [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 848-854. |
| [3] | Yanbin ZHANG,Guangye GUO,Caihua ZHENG,Xinyan LIU. Research progress in association between Helicobacter pylori and metabolic syndrome and its effect on occurrence and development of metabolic syndrome [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1757-1762. |
| [4] | Shuang HUANG,Chen CHEN,Bo HUANG. Effects of limonin on lipid metabolism and intestinal flora in nutritionally obese rats [J]. Journal of Jilin University(Medicine Edition), 2022, 48(4): 858-865. |
| [5] | Mimi REN,Menghan GAO,Jing WANG,Jiamei LAI,Jinyu YU,Hang YUAN. Protective effect of 12/15-lipoxygenase gene knockout on kidney tissue of obesity-related glomerulopathy model mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(6): 1337-1346. |
| [6] | Yong HE,Li HONG,Guotao HUANG,Zhihan ZHAO. Effect of palmitic acid on induction of lipid deposition in skeletal muscle cells [J]. Journal of Jilin University(Medicine Edition), 2021, 47(6): 1380-1385. |
| [7] | Yan ZHAO,Pengcheng YU,Yu WANG,Yingping WANG,Pingya LI,Jinping LIU. Effect of apoptosis of 3T3-L1 adipocytes induced by panaxadiol and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1154-1161. |
| [8] | ZHAO Jun, LIANG Jinyu. Improvement effects of aerobic exercise combined with resistance training on body composition, cardiovascular function and serum C-reactive protein level in male obese college students [J]. Journal of Jilin University(Medicine Edition), 2019, 45(05): 1134-1140. |
| [9] | JIN Runhao, XU Zhongfu, QUAN Zhenyu, LI Qing, HAN Chunji. Epidemiologic status of overweight and obesity in children and adolescents in Yanji City of Jilin Province and analysis on their influencing factors [J]. Journal of Jilin University(Medicine Edition), 2018, 44(05): 1078-1085. |
| [10] | CHEN Qiong, ZHAO Lijun. Improvement effect of aerobic exercise on haemodynamics and exercise endurance of male old patients with simple obesity [J]. Journal of Jilin University Medicine Edition, 2017, 43(05): 990-995. |
| [11] | XU Jin, CHEN Huaiji, XU Feng, WANG Qi, ZHANG Yuezhu, LIU Hongbo, ZHANG Tianrong, YE Lin. Association between phthalate ester exposure and population obesity:A Meta-analysis [J]. Journal of Jilin University Medicine Edition, 2017, 43(02): 306-310. |
| [12] | WANG Zhi-fan,MA Hui,CHEN Wang-shen,YANG Xiu-lin. Influence of high-fat diet in intestinal flora and fecal weight in SD rats and its significance [J]. Journal of Jilin University Medicine Edition, 2014, 40(04): 734-738. |
| [13] | ZHANG Li,LIANG Ming-hui,SU Ying-ying,YANG Xiao-lian,SONG Chang,LIU Ting,WU Ying. Survey and analysis on associations between dietary diversity and overweight,obesity of rural adults in Jilin Province [J]. Journal of Jilin University Medicine Edition, 2014, 40(03): 682-685. |
| [14] | YAO Yu-hang,ZHONG Lei,LIU Yu-chi,FU Yao,ZHU Ying-jie,PAN Yang, LIU Jian-wei. Survey on epidemiological characteristics and influening factors of overweight,obesity in adults in Jilin province [J]. Journal of Jilin University Medicine Edition, 2013, 39(5): 1051-1056. |
| [15] | ZHU Yong-xiang,WANG Qian,WANG Shuang,YU Wei,NAN Ying,CAO Jian. Obesity and mechanisms of appetite regulation [J]. Journal of Jilin University Medicine Edition, 2013, 39(5): 1067-1070. |
|