Journal of Jilin University(Medicine Edition) ›› 2021, Vol. 47 ›› Issue (6): 1337-1346.doi: 10.13481/j.1671-587X.20210601
• Research in basic medicine • Next Articles
Mimi REN,Menghan GAO,Jing WANG,Jiamei LAI,Jinyu YU,Hang YUAN(
)
Received:2021-06-29
Online:2021-11-28
Published:2021-12-14
Contact:
Hang YUAN
E-mail:hangyuan75@foxmail.com
CLC Number:
Mimi REN,Menghan GAO,Jing WANG,Jiamei LAI,Jinyu YU,Hang YUAN. Protective effect of 12/15-lipoxygenase gene knockout on kidney tissue of obesity-related glomerulopathy model mice and its mechanism[J].Journal of Jilin University(Medicine Edition), 2021, 47(6): 1337-1346.
Tab.1
Primer sequences"
| Primer | Sequence |
|---|---|
| Adiponectin (M) | Forward:GTTGCAAGCTCTCCTGTTCC Reverse:TCTCCAGGAGTGCCATCTCT |
| TNF-α (M) | Forward:TGTTGCCTCCTCTTTTGCTT Reverse:TGGTCACCAAATCAGCGTTA |
| IL-6 (M) | Forward:ACAAAGCCAGAGTCCTTC Reverse:ACCACAGTGAGGAATGTCCAC |
| MCP-1 (M) | Forward:TTAAAAACCTGGATCGGAACC Reverse:GCATTAGCTTCAGATTTACGG |
| PAI-1 (M) | Forward:GACGCCTTCATTTGGACGAA Reverse:CGGACCTTTTCCCTTCAAGAGTCCG |
| TGF-β1 (M) | Forward:AGGAAGGACCTGGGTTGGAAG Reverse:CGTCTCGACCCACGTAGTAGACG |
| CTGF (M) | Forward:CAGCTCCGAGAAGGGTCAAGCTG Reverse:AACAGGCGCTCCACTCTGTG |
| COL 1a1 (M) | Forward:CGGATAGCAGATTGAGAACATCCG Reverse:CGGCTGAGTAGGGAACACACA |
| β-actin (R/M) | Forward:CCCTGTATGCCTCTGGTCGT Reverse:CGGACGCAGCTCAGTAACAGTCCG |
| 1 | COLLINS A J, FOLEY R N, HERZOG C, et al. Excerpts from the US renal data system 2009 annual data report[J]. Am J Kidney Dis, 2010, 55(1): A6-A7. |
| 2 | CAO H. Adipocytokines in obesity and metabolic disease[J]. J Endocrinol, 2014, 220(2): T47-T59. |
| 3 | CHAGNAC A, WEINSTEIN T, KORZETS A, et al. Glomerular hemodynamics in severe obesity[J]. Am J Physiol Ren Physiol, 2000, 278(5): F817-F822. |
| 4 | XU H Z, CHENG Y L, WANG W N,et al. 12-lipoxygenase inhibition on microalbuminuria in type-1 and type-2 diabetes is associated with changes of glomerular angiotensin II type 1 receptor related to insulin resistance[J]. Int J Mol Sci, 2016, 17(5): 684. |
| 5 | DOBRIAN A D, MORRIS M A, TAYLOR-FISHWICK D A, et al. Role of the 12-lipoxygenase pathway in diabetes pathogenesis and complications[J]. Pharmacol Ther, 2019, 195: 100-110. |
| 6 | YUAN H, REDDY M A, DESHPANDE S, et al. Epigenetic histone modifications involved in profibrotic gene regulation by 12/15-lipoxygenase and its oxidized lipid products in diabetic nephropathy[J]. Antioxid Redox Signal, 2016, 24(7): 361-375. |
| 7 | TERSEY S A, MAIER B, NISHIKI Y, et al. 12-lipoxygenase promotes obesity-induced oxidative stress in pancreatic islets[J]. Mol Cell Biol, 2014, 34(19): 3735-3745. |
| 8 | TRAJCEVSKI K E, O’NEILL H M, WANG D C,et al.Enhanced lipid oxidation and maintenance of muscle insulin sensitivity despite glucose intolerance in a diet-induced obesity mouse model[J]. PLoS One, 2013, 8(8): e71747. |
| 9 | YEUNG J, HOLINSTAT M. 12-lipoxygenase: a potential target for novel anti-platelet therapeutics[J]. Cardiovasc Hematol Agents Med Chem,2011,9(3): 154-164. |
| 10 | LOPATEGI A, LÓPEZ-VICARIO C, ALCARAZ-QUILES J, et al. Role of bioactive lipid mediators in obese adipose tissue inflammation and endocrine dysfunction[J]. Mol Cell Endocrinol, 2016, 419: 44-59. |
| 11 | CHAKRABARTI S K, WEN Y, DOBRIAN A D,et al. Evidence for activation of inflammatory lipoxygenase pathways in visceral adipose tissue of obese Zucker rats[J].Am J Physiol Endocrinol Metab,2011,300(1): E175-E187. |
| 12 | MA K, NUNEMAKER C S, WU R,et al. 12-lipoxygenase products reduce insulin secretion and β-cell viability in human islets[J]. J Clin Endocrinol Metab, 2010,95(2): 887-893. |
| 13 | HERNANDEZ-PEREZ M, CHOPRA G, FINE J,et al. Inhibition of 12/15-lipoxygenase protects against β-cell oxidative stress and glycemic deterioration in mouse models of type 1 diabetes[J]. Diabetes, 2017, 66(11): 2875-2887. |
| 14 | UYSAL K T, WIESBROCK S M, HOTAMISLIGIL G S.Functional analysis of tumor necrosis factor (TNF) receptors in TNF-α-mediated insulin resistance in genetic obesity[J]. Endocrinology, 1998, 139(12): 4832-4838. |
| 15 | KUME S, UZU T, ARAKI S, et al. Role of altered renal lipid metabolism in the development of renal injury induced by a high-fat diet[J]. J Am Soc Nephrol, 2007, 18(10): 2715-2723. |
| 16 | ROUBICEK T, BARTLOVA M, KRAJICKOVA J, et al. Increased production of proinflammatory cytokines in adipose tissue of patients with end-stage renal disease[J]. Nutrition, 2009, 25(7/8): 762-768. |
| 17 | LIAO M T, SUNG C C, HUNG K C, et al. Insulin resistance in patients with chronic kidney disease[J]. J Biomed Biotechnol, 2012, 2012: 691369. |
| 18 | PARVANOVA A I, TREVISAN R, ILIEV I P, et al. Insulin resistance and microalbuminuria: a cross-sectional, case-control study of 158 patients with type 2 diabetes and different degrees of urinary albumin excretion[J]. Diabetes, 2006, 55(5): 1456-1462. |
| 19 | CUSUMANO A M, BODKIN N L, HANSEN B C, et al. Glomerular hypertrophy is associated with hyperinsulinemia and precedes overt diabetes in aging rhesus monkeys[J]. Am J Kidney Dis, 2002, 40(5): 1075-1085. |
| 20 | ABRASS C K, RAUGI G J, GABOUREL L S, et al. Insulin and insulin-like growth factor I binding to cultured rat glomerular mesangial cells[J]. Endocrinology, 1988, 123(5): 2432-2439. |
| 21 | CHAKRABARTI S K, COLE B K, WEN Y, et al. 12/15-lipoxygenase products induce inflammation and impair insulin signaling in 3T3-L1 adipocytes[J]. Obesity (Silver Spring), 2009, 17(9): 1657-1663. |
| [1] | Lingyu WANG,Ruili LI,Yu ZHANG,Meitong GUO,Yalong LIANG,Xu HAN,Xiaowei HUANG,Yang ZHANG,Xiuhua YU. Improvement effect of Renshen Jianzhi Tablets on learning and memory ability in cognitive impairment model rats and its protective effect on hippocampal neurons and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 719-729. |
| [2] | Zhenya DONG,Xinge ZHANG,Yaya DENG,Jingling ZHU,Huiling JIAN,Yunhua ZHANG. Effect of Furin expression regulated by specific protein 1 on asprosin secretion in adipocytes and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 299-307. |
| [3] | Jingyuan WANG,Fang CHEN,Yancun LIU,Shixin LI,Songtao SHOU. Protective effect of silencing coagulation factor V gene on septic rats by inhibiting JNK1/2 and p38 MAPK signaling pathways [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 418-428. |
| [4] | Liyang BAI,Di MA,Shuo HUANG,Chuan WANG,Jiaxin LIANG,Tian WANG,Liuping CUI,Lingmin ZHAO,Meizhen XIE,Mengyue YAO,Ying CHEN,Lijuan WANG. Effect of carotid plaque composition and HDL-C levels on symptomatic carotid artery stenosis [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 491-498. |
| [5] | Huiyan ZHU,Min CHEN,Jinxian LI,Chunli LI. Effect of enriched environment on neurofunctional damage in rats with ischemic stroke via transcription factor EB-mediated autophagy [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 116-124. |
| [6] | Sitong CHEN,Dan YANG,Qingjie LI,Xiaolei TANG,Han WANG,Yangyang LIU,Tiejun LIU. Ameliorative effect of puerarin on non-alcoholic fatty liver disease induced by high-fat diet in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 44-55. |
| [7] | Sifan FENG,Yunfeng LI,Jiaying WANG,Fubin MA,Yan WANG. Effects of heme-binding protein 1 gene knockdown on proliferation, migration, and inflammatory response of microglia BV2 and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1532-1541. |
| [8] | Tao SUN,Zhiyin DAI,Xuan LI,Chaopu ZHANG,Shu DING,Jianwei ZHAO. Predictive value of pan-immune-inflammation index for major adverse cardiovascular events within 1 year after PCI in elderly patients with coronary heart disease [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1655-1660. |
| [9] | Di QIN,Lihong HUAGN,Qingshuang ZHENG,Jingjing SUN,Weimin XU. Analysis on correlation between serum pro-inflammatory cytokines and muscle mass in elderly patients with sarcopenic obesity and diabetes [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1293-1302. |
| [10] | Ying HU,Yong HUANG. Improvement effect of short-chain fatty acids on inflammation-induced autophagic damage in ovarian granulosa cells in polycystic ovary syndrome and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1340-1348. |
| [11] | Guang YANG,Zhifang ZHENG,Xinhua ZHANG. Research progress in protective effect of miRNA on neonatal hypoxic-ischemic brain injury [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1423-1428. |
| [12] | Qi WANG,Lingyu JIANG,Xiangrong LIU. Research progress in application of weight-adjusted waist circumference index in risk prediction and evaluation of obesity-related diseases [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 848-854. |
| [13] | Junjie JIANG,Hao WU,Kang HE,Zhiqiang SAN,Qing YANG,Hui LI,Na LI. Repair effect of ginseng polypeptide thermosensitive hydrogel on heat-induced skin injury in rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 360-369. |
| [14] | Xiaoxia HU,Yalong LI,Dongliang YANG,Bazeren LA,Xinyue LIU. Effect of high glucose on polarization of Raw264.7 macrophages in vitro [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 403-411. |
| [15] | Xingqi SU,Lingmin ZHAO,Di MA,Jiulin YOU,Ying CHEN,Liangshu FENG,Jing WANG,Jiachun FENG,Chuan WANG. Analysis on correlation of cerebral infarct area with cytokines and immune status in patients with acute ischemic stroke [J]. Journal of Jilin University(Medicine Edition), 2025, 51(1): 124-132. |
|