敲减血红素结合蛋白1基因对小胶质细胞BV2增殖、迁移及炎症反应的影响及其机制

doi:10.13481/j.1671-587X.20250609

Abstract

Abstract:

Objective To explore the effect of heme-binding protein 1（HEBP1） down-regulation on the function of microglia BV2， and to clarify the key role of HEBP1 in the microglia. Methods Negative control and HEBP1 knockdown small interfering RNA （siRNA） were constructed to knockdown HEBP1 gene in mouse-derived microglial BV2， and the HEBP1 knockdown BV2 cell models were obtained. The BV2 cells were divided into si-NC group， si-HEBP1-1 group， si-HEBP1-2 group， and si-HEBP1-3 group. Real-time fluorescence quantitative PCR（RT-qPCR） and Western blotting methods were used to detect the expression levels of HEBP1 mRNA and protein in the BV2 cells after knockdown； the siRNA with the most significart knockdown effect was selected for stlbsequent expreriments.The proliferation abilities of the cells in si-NC group and si-HEBP1 group were detected by cell counting kit-8（CCK-8） assay， and the cell migration rates were assessed by scratch assay； the cellular mitochondrial membrane potential and reactive oxygen species （ROS） levels were detected by kits； the cellular mitochondrial respiratory function was detected by mitochondrial respirometer. The BV2 cells were divided into si-NC group， si-NC+lipopolysacch aride（LPS） group， si-HEBP1 group， and si-HEBP1+LPS group. RT-qPCR method was used to detect the expression levels of HEBP1， interleukin-1β（IL-1β），tumor necrosis factor-α（TNF-α），and interleukin-6（IL-6） mRNA in the BV2 cells in various groups， and Western blotting method was used to detect the expression levels of HEBP1 protein in the BV2 cells in various groups. Results When the BV2 cells were transfected with siRNA carrying with red fluorescence tag CY3， the transfect effricacy was above 90%； compared with si-NC group， the expression levels of HEBP1 protein in the BV2 cells in si-HEBP1-1 group， si-HEBP1-2 group， and si-HEBP1-3 group were significantly decreased （P<0.05 or P<0.01）， especially in si-HEBP1-1 group. Compared with si-NC group， the expression levels of HEBP1 mRNA in the BV2 cells in si-HEBP1-1 group， si-HEBP1-2 group， and si-HEBP1-3 group were significantly decreased （P<0.01）， especially in si-HEBP1-1 group； indicating that si-HEBP1-1 was the siRNA with best HEBP1 knowdown effect， and the HEBP1 knockdown BV2 cell model was successfully constructed. The CCK-8 resuts showed that compared with si-NC group， the proliferation activities of the BV2 cells in si-HEBP1 group were decreased （P<0.05 or P<0.01）； from 90 min， the differences in proliferation activities of the BV2 cells in two groups were obvious. The cell scratch experiment results showed that compared with si-NC group， the cell migration rate in si-HEBP1 group was significantly decreased （P<0.05）. The fluorescence microscope results showed that compared with si-NC group， the mitochondrial membrane potential of the BV2 cells in si-HEBP1 group was significantly decreased （P<0.05）； compared with si-NC group， the ROS level in the BV2 cells in si-HEBP1 group was significantly increased（P<0.05）. The mitochondrial respiration function testing results showed that compared with si-NC group， routine respiration（ROUNTINE） and leak respiration（LEAK） in si-HEBP1 group were significautly decreased （P<0.05 or P<0.01）， and electron transfer system capacity（ETS） and residual oxygen consumption（ROX） had no significant differences （P>0.05）； the ATP amount was decreased （P<0.05）. The RT-qPCR results showed that compared with si-NC group， the expression levels of IL-1β， TNF-α， and IL-6 mRNA in the BV2 cells in si-NC+LPS group were significantly decreased （P<0.01）； compared with si-HEBP1 group， the expression levels of IL-1β， TNF-α， and IL-6 mRNA in the BV2 cells in si-HEBP1+LPS group were significantly decreased （P<0.01）； compared with si-NC+LPS group， the expression levels of IL-1β， TNF-α， and IL-6 mRNA in the BV2 cells in si-HEBP1+LPS group were significantly increased （P<0.01）. Conclusion Knockdown of HEBP1 gene can decrease the proliferation and migration abilities of the microglia BV2 and increase inflammatory response to LPS stimulus， and their mechanisms may be related to mitochondrial function damage and decreased ATP production of the BV2 cells.

Key words: Heme-binding protein 1, Microglia, Mitochondrial function, Neuroinflammation, Ractive oxygen species, Cell proliferation, Cell migration

CLC Number:

R741.02

Sifan FENG,Yunfeng LI,Jiaying WANG,Fubin MA,Yan WANG. Effects of heme-binding protein 1 gene knockdown on proliferation, migration, and inflammatory response of microglia BV2 and their mechanisms[J].Journal of Jilin University(Medicine Edition), 2025, 51(6): 1532-1541.

Figures/Tables 12

Tab.1

Tab.2

Fig. 1

Fig. 2

Tab.3

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Tab.4

Tab.5

References 29

[1]	YAGENSKY O， KOHANSAL-NODEHI M， GUNASEELAN S， et al. Increased expression of heme-binding protein 1 early in Alzheimer’s disease is linked to neurotoxicity［J］. eLife， 2019， 8： e47498.
[2]	GOODFELLOW B J， FREIRE F， CARVALHO A L， et al. The SOUL family of heme-binding proteins： Structure and function 15 years later［J］. Coord Chem Rev， 2021， 448： 214189.
[3]	CHUA J J E. HEBP1 - An early trigger for neuronal cell death and circuit dysfunction in Alzheimer’s disease［J］. Semin Cell Dev Biol， 2023， 139： 102-110.
[4]	YIN G N. Pericyte-derived heme-binding protein 1 promotes angiogenesis and improves erectile function in diabetic mice［J］. Investig Clin Urol， 2022， 63（4）： 464-474.
[5]	NICKEL W， RABOUILLE C. Mechanisms of regulated unconventional protein secretion［J］. Nat Rev Mol Cell Biol， 2009， 10（2）： 148-155.
[6]	DEVOSSE T， DUTOIT R， MIGEOTTE I， et al. Processing of HEBP1 by cathepsin D gives rise to F2L， the agonist of formyl peptide receptor 3［J］. J Immunol， 2011， 187（3）： 1475-1485.
[7]	GAO J L， GUILLABERT A， HU J Y， et al. F2L， a peptide derived from heme-binding protein， chemoattracts mouse neutrophils by specifically activating Fpr2， the low-affinity N-formylpeptide receptor［J］. J Immunol， 2007， 178（3）： 1450-1456.
[8]	MIGEOTTE I， RIBOLDI E， FRANSSEN J D， et al. Identification and characterization of an endogenous chemotactic ligand specific for FPRL2［J］. J Exp Med， 2005， 201（1）： 83-93.
[9]	CHEN K Q， IRIBARREN P， HU J Y， et al. Activation of Toll-like receptor 2 on microglia promotes cell uptake of Alzheimer disease-associated amyloid beta peptide［J］. J Biol Chem， 2006， 281（6）： 3651-3659.
[10]	CUI Y H， LE Y Y， GONG W H， et al. Bacterial lipopolysaccharide selectively up-regulates the function of the chemotactic peptide receptor formyl peptide receptor 2 in murine microglial cells［J］. J Immunol， 2002， 168（1）： 434-442.
[11]	CUI Y H， LE Y， ZHANG X， et al. Up-regulation of FPR2， a chemotactic receptor for amyloid beta 1-42 （a beta 42）， in murine microglial cells by TNF alpha［J］. Neurobiol Dis， 2002， 10（3）： 366-377.
[12]	GOMEZ PERDIGUERO E， KLAPPROTH K， SCHULZ C， et al. Tissue-resident macrophages originate from yolk-sac-derived erythro-myeloid progenitors［J］. Nature， 2015， 518（7540）： 547-551.
[13]	BOTELLA LUCENA P， HENEKA M T. Inflammatory aspects of Alzheimer’s disease［J］. Acta Neuropathol， 2024， 148（1）： 31.
[14]	FROST J L， SCHAFER D P. Microglia： architects of the developing nervous system［J］. Trends Cell Biol， 2016， 26（8）： 587-597.
[15]	SCHAFER D P， LEHRMAN E K， KAUTZMAN A G， et al. Microglia sculpt postnatal neural circuits in an activity and complement-dependent manner［J］. Neuron， 2012， 74（4）： 691-705.
[16]	CAI Y L， LIU J L， WANG B， et al. Microglia in the neuroinflammatory pathogenesis of Alzheimer’s disease and related therapeutic targets［J］. Front Immunol， 2022， 13： 856376.
[17]	HANISCH U K， KETTENMANN H. Microglia： active sensor and versatile effector cells in the normal and pathologic brain［J］. Nat Neurosci， 2007， 10（11）： 1387-1394.
[18]	NAYAK D， ROTH T L， MCGAVERN D B. Microglia development and function［J］. Annu Rev Immunol， 2014， 32： 367-402.
[19]	XIE Z， MENG J， WU Z， et al. The dual nature of microglia in Alzheimer’s disease： a microglia-neuron crosstalk perspective［J］. Neuroscientist， 2023， 29（5）： 616-638.
[20]	YAN H Y， WANG W， CUI T T， et al. Advances in the understanding of the correlation between neuroinflammation and microglia in Alzheimer’s disease［J］. Immunotargets Ther， 2024， 13： 287-304.
[21]	CALSOLARO V， EDISON P. Neuroinflammation in Alzheimer’s disease： Current evidence and future directions［J］. Alzheimers Dement， 2016， 12（6）： 719-732.
[22]	TWAROWSKI B， HERBET M. Inflammatory processes in Alzheimer’s disease-pathomechanism， diagnosis and treatment： a review［J］. Int J Mol Sci， 2023， 24（7）： 6518.
[23]	FITZGERALD K A， KAGAN J C. Toll-like receptors and the control of immunity［J］. Cell， 2020， 180（6）： 1044-1066.
[24]	NABI S U， KHAN A， SIDDIQUI E M， et al. Mechanisms of mitochondrial malfunction in Alzheimer’s disease： new therapeutic hope［J］. Oxid Med Cell Longev， 2022， 2022： 4759963.
[25]	LI Y， XIA X H， WANG Y， et al. Mitochondrial dysfunction in microglia： a novel perspective for pathogenesis of Alzheimer’s disease［J］. J Neuroinflammation， 2022， 19（1）： 248.
[26]	JOHANNSEN D L， RAVUSSIN E. The role of mitochondria in health and disease［J］. Curr Opin Pharmacol， 2009， 9（6）： 780-786.
[27]	KAMATHAM P T， SHUKLA R， KHATRI D K， et al. Pathogenesis， diagnostics， and therapeutics for Alzheimer’s disease： Breaking the memory barrier［J］. Ageing Res Rev， 2024， 101： 102481.
[28]	WANG L X， PAVLOU S， DU X， et al. Glucose transporter 1 critically controls microglial activation through facilitating glycolysis［J］. Mol Neurodegener， 2019， 14（1）： 2.
[29]	PRADEEPKIRAN J A， REDDY P H. Defective mitophagy in Alzheimer’s disease［J］. Ageing Res Rev， 2020， 64： 101191.

Primer	Sequence(5'-3')
Si-HEBP1-1	F： CUGUGGAAGUGACAGACAATT
Si-HEBP1-1	R： UUGUCUGUCACUUCCACAGTT
Si-HEBP1-2	F： CUUUUGCCGUGUUUCCCAATT
Si-HEBP1-2	R： UUGGGAAACACGGCAAAAGTT
Si-HEBP1-3	F： CCAGUGAUGAGAGUGUGAATT R： UUCACACUCUCAUCACUGGTT
Si-NC	F： UUCUCCGAACGUGUCACGUTT R： ACGUGACACGUUCGGAGAATT

Primer	Sequence(5'-3')
HEBP1	F: CTGTTCGGGAGCGTGGAAA
HEBP1	R: CAGTAGCAAACTTGCCCCCTT
IL-1β	F:GGGCCTCAAAGGAAAGAATCT
IL-1β	R:GAGGTGCTGATGTACCAGTTGG
IL-6	F: TAGTCCTTCCTACCCCAATTTCC R: TTGGTCCTTAGCCACTCCTTC
TNF-α	F:GACGTGGAACTGGCAGAAGAG R:TTGGTGGTTTGTGAGTGTGAG
GAPDH	F: AAGAGGGATGCTGCCCTTAC R: TACGGCCAAATCCGTTCACA

Group	HEBP1 mRNA
Si-NC	1.00±0.05
Si-HEBP1-1	0.01±0.03^*
Si-HEBP1-2	0.30±0.14^*
Si-HEBP1-3	0.38±0.12^*

Group	ROUNTINE	LEAK	EST	ROX	ATP
Si-NC	36.44±0.80	19.31±0.31	72.35±18.08	5.57±1.35	17.06±0.57
Si-HEBP1	32.99±1.37^*	17.94±0.40^**	54.06±2.16	5.16±0.73	15.04±1.11^*

Group	IL-1β	TNF-α	IL-6
Si-NC	1.00±0.05	1.00±0.05	1.00±0.05
Si-HEBP1	0.94±0.48	1.22±0.38	2.21±1.15
Si-NC+LPS	1 139.35±211.34^*	10.22±3.58^*	174.96±37.05^*
Si-HEBP1+LPS	2 447.83±476.00^△#	19.15±2.38^△#	309.17±44.25^△#

Effects of heme-binding protein 1 gene knockdown on proliferation, migration, and inflammatory response of microglia BV2 and their mechanisms

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 12

References 29

Related Articles 15

Metrics

Comments

Recommended 10

[1]	Xiao ZHOU,Haitao DAI,Yunshan DING,Linjie ZHANG,Nan WU. Network pharmacology analysis and in vitro experimental validation of anticancer effect of grape seed proanthocyanidins against oral squamous cell carcinoma [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 651-662.
[2]	Qiaotong REN,Weihua WU,Xingxiang WANG,Shichao WANG,Yipeng CHENG,Chun LI. Effect of interleukin-17 recepter B gene silencing on proliferation, invasion and apoptosis of lung adenocarcinoma A549 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 738-745.
[3]	Yao ZHENG,Mingxia FU,Weichen WANG,Weiwei CHEN,Yuchen HAN,Yu BAI,Jiajia AN. Effect of sodium selenite on biological behaviors of breast cancer doxorubicin-resistant MCF-7/ADR cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 410-417.
[4]	Li ZHAI,Meng CHEN,Jianbo LUO,Aili ZHANG,Liangxiao WANG,Ying WEI,Xi ZHANG. Targeting relationship between miR-214-3p and EZH2 and its effects on proliferation， invasion， and apoptosis of ovarian cancer SKOV3 cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 460-468.
[5]	Hong LI,Panpan YU,Zouyu ZHAO,Chongfeng SUN,Hui QIAO,Ping YANG. Expression of GSTO1 in ovarian cancer tissue and effect of N-glycosylation site mutations on biological behaviors of epithelial ovarian cancer cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 469-482.
[6]	Yunshan DING,Haitao DAI,Min CHEN,Xiaohui HAO,Xiao ZHOU,Nan WU. Effect of silencing TRPV2 gene and cannabidiol on biological behaviors of oral squamous cell carcinoma CAL-27 cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 143-151.
[7]	Yan ZHAO,Huawei WU. Inhibitory effect of inhibition of miR-17-5p on proliferation of spinal cord astrocytes of rats induced by scratch injury through targeting Mfn2 expression [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 81-92.
[8]	Xiaohan YAO,Mingchen YAO,Zhiqing WANG,Heyang LI,Yan YAN,Ningjing LEI. Effect of silencing GPR139 gene on proliferation, apoptosis and autophagy of breast cancer cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 1-9.
[9]	Lulu FU,Yinggang ZOU,Xiaoyu ZHENG,Xueying ZHANG,Jingshun ZHANG,Min WANG,Qiang ZHANG,Lianwen ZHENG. Expression of placenta expressed transcription factor 1 in ovarian tissue of polycystic ovary syndrome rats and its effect on proliferation of rat ovarian granulosa cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1177-1184.
[10]	Pingsheng ZHU,Sitang GE,Lugen ZUO,Deli CHEN,Yangyang ZHANG. Effect of miR-325-3p targeting PRELID1 gene in regulation of EMT pathway on invasion and migration of colon cancer cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1185-1193.
[11]	Guang YANG,Zhifang ZHENG,Xinhua ZHANG. Research progress in protective effect of miRNA on neonatal hypoxic-ischemic brain injury [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1423-1428.
[12]	Wenxuan LI,Minru ZONG. Research progress in role of migration of Schwann cells in repairment of peripheral nerve injury [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 1137-1144.
[13]	Zhongjun SHEN,Yao ZHAO,Mingbo JIA,Liyan ZHAO. Research progress in effects of hypoxia-inducible factors on cell migration and invasion during epithelial-mesenchymal transition in glioma cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 1145-1154.
[14]	Yixuan GAO,Peng WANG,Silong ZHANG,Ruijuan GAO,Yingfang MA,Keke ZHANG,Dan FENG,Zongqi HUANG,Ketao MA,Li LI,Junqiang SI. Inhibitory effect of safranal on proliferation, migration and phenotypic transformation of vascular smooth muscle cells of rats induced by high glucose in vitro [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 948-957.
[15]	Xiaoshuang HE,Lina XU,Mei CUI,Yu ZHAO,Bei WANG,Zheng HUANG,Yuchao WANG,Wenyan XIN,Chao WU. Effects of lncRNA DUXAP8 in lung cancer A549 cells-derived exosomes on lung cancer cell growth and its mechnism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 958-967.