Journal of Jilin University(Medicine Edition) ›› 2023, Vol. 49 ›› Issue (4): 840-849.doi: 10.13481/j.1671-587X.20230403
• Research in basic medicine • Previous Articles Next Articles
Xuying WANG,Mingzhen JING(
),Jin YU,Rong FU,Ru YANG
Received:2022-07-27
Online:2023-07-28
Published:2023-07-26
Contact:
Mingzhen JING
E-mail:304101925@qq.com
CLC Number:
Xuying WANG,Mingzhen JING,Jin YU,Rong FU,Ru YANG. Effects of miR-181a-5p and BACH2 expressions on apoptosis and invasion of leukemic CCRF-CEM cells[J].Journal of Jilin University(Medicine Edition), 2023, 49(4): 840-849.
Tab.1
PCR primer sequences"
| Primer | Sequence (5'-3') |
|---|---|
| MMP-9 | F:GTCCTCGCCCTGAACCTG |
| R:GGCACAGTAGTGGCCGTAGA | |
| MMP-14 | F:ATCATTGAGGTGGACGAGG |
| R:GGGAACGCTGGCAGTAG | |
| BACH2 | F:AGCAAGAACCGCATCGC |
| R:TGGGAAAGGCAGGAGAAG | |
| GAPDH | F:GGGAAACTGTGGCGTGAT |
| R:GAGTGGGTGTCGCTGTTGA | |
| miR-181a-5p | F:GGAACATTCAACGCTGTCG |
| R:CTGGTGTCGTGGAGTCGG | |
| U6 | F:CTCGCTTCGGCAGCACA |
| R:AACGCTTCACGAATTTGCGT |
Tab.2
Proliferation activities of cells in various groups"
| Group | Proliferation activity | ||
|---|---|---|---|
| (t/h) 24 | 48 | 72 | |
| Control | 0.79±0.02 | 0.95±0.01 | 1.05±0.01 |
| Inhibitor-NC | 0.79±0.02 | 0.97±0.01 | 1.05±0.01 |
| MiR-181a-5p inhibitor | 0.69±0.01 | 0.76±0.02* | 0.79±0.14* |
| OverExpBACH2 | 0.62±0.01 | 0.70±0.01* | 0.74±0.03* |
| MiR-181a-5p inhibitor+EV | 0.69±0.00 | 0.77±0.02* | 0.81±0.04* |
| MiR-181a-5p inhibitor+overExpBACH2 | 0.57±0.01 | 0.64±0.01*△# | 0.65±0.09*△# |
Tab.3
Percentages of cells at G2 phase and apoptotic rates of cells in various groups"
| Group | Percentage of cells at G2 phase | Apoptotic rate |
|---|---|---|
| Control | 10.72±0.26 | 6.58±0.52 |
| Inhibitor-NC | 10.42±0.26 | 7.14±0.36 |
| MiR-181a-5p inhibitor | 16.76±0.47* | 24.93±0.61* |
| OverExpBACH2 | 19.11±0.38* | 28.35±1.69* |
| MiR-181a-5p inhibitor+EV | 16.45±0.24* | 24.39±0.67* |
| MiR-181a-5p inhibitor+overExpBACH2 | 24.16±0.27*△# | 38.56±0.68*△# |
Tab.4
Expression levels of MMP-9, MMP-14, BACH2 mRNA, and miR-181a-5p in cells in various groups"
| Group | MMP-9 mRNA | MMP-14 mRNA | BACH2 mRNA | miR-181a-5p |
|---|---|---|---|---|
| Control | 1.00±0.02 | 1.00±0.02 | 1.00±0.05 | 1.00±0.01 |
| Inhibitor-NC | 1.07±0.10 | 1.03±0.10 | 0.90±0.10 | 0.98±0.03 |
| MiR-181a-5p inhibitor | 0.45±0.06* | 0.50±0.06* | 1.82±0.15* | 0.52±0.02* |
| OverExpBACH2 | 0.28±0.02* | 0.26±0.02* | 10.13±0.32* | 0.29±0.02* |
| MiR-181a-5p inhibitor+EV | 0.43±0.02* | 0.41±0.02* | 2.01±0.27* | 0.49±0.06* |
| MiR-181a-5p inhibitor+overExpBACH2 | 0.08±0.01*△# | 0.10±0.01*△# | 17.03±1.36*△# | 0.13±0.01*△# |
| 1 | GUTIERREZ-CAMINO A, GARCIA-OBREGON S, LOPEZ-LOPEZ E, et al. miRNA deregulation in childhood acute lymphoblastic leukemia: a systematic review[J]. Epigenomics, 2020, 12(1): 69-80. |
| 2 | NABIZADEH F, MOMTAZ S, GHANBARI-MOVAHED M, et al. Pediatric acute lymphoblastic leukemia management using multitargeting bioactive natural compounds: a systematic and critical review[J]. Pharmacol Res, 2022, 177: 106116. |
| 3 | LYU X M, LI J B, YUN X, et al. miR-181a-5p, an inducer of Wnt-signaling, facilitates cell proliferation in acute lymphoblastic leukemia[J]. Oncol Rep, 2017, 37(3): 1469-1476. |
| 4 | YANG C, PASSOS GIBSON V, HARDY P. The role of miR-181 family members in endothelial cell dysfunction and tumor angiogenesis[J].Cells, 2022, 11(10): 1670. |
| 5 | LIU X D, LIAO W, PENG H X, et al. miR-181a promotes G1/S transition and cell proliferation in pediatric acute myeloid leukemia by targeting ATM[J]. J Cancer Res Clin Oncol, 2016, 142(1): 77-87. |
| 6 | ZHENG Y X, LU Y W, HUANG X F, et al. BACH2 regulates the function of human CD4+CD45RA-Foxp3l ° cytokine-secreting T cells and promotes B-cell response in systemic lupus erythematosus[J]. Eur J Immunol, 2020, 50(3): 426-438. |
| 7 | 王旭颖, 荆明箴, 付 荣, 等. 过表达转录因子BACH2对人急性淋巴细胞白血病T淋巴细胞活力及凋亡的影响[J]. 中国病理生理杂志, 2020, 36(10): 1776-1781. |
| 8 | LIGUORI M, NUZZIELLO N, LICCIULLI F, et al. Combined microRNA and mRNA expression analysis in pediatric multiple sclerosis: an integrated approach to uncover novel pathogenic mechanisms of the disease[J]. Hum Mol Genet, 2018, 27(1): 66-79. |
| 9 | LV M, LIU Y, LIU W,et al.Immunotherapy for pediatric acute lymphoblastic leukemia: recent advances and future perspectives[J].Front Immunol,2022,13:921894. |
| 10 | BERGERON B P, DIEDRICH J D, ZHANG Y, et al. Epigenomic profiling of glucocorticoid responses identifies cis-regulatory disruptions impacting steroid resistance in childhood acute lymphoblastic leukemia[J]. Leukemia, 2022, 36(10): 2374-2383. |
| 11 | ZHANG L X, GAO J, LONG X, et al. The circular RNA circHMGB2 drives immunosuppression and anti-PD-1 resistance in lung adenocarcinomas and squamous cell carcinomas via the miR-181a-5p/CARM1 axis[J]. Mol Cancer, 2022, 21(1): 110. |
| 12 | VON BEEK C, ALRIKSSON L, PALLE J, et al. Dynamin inhibition causes context-dependent cell death of leukemia and lymphoma cells[J]. PLoS One, 2021, 16(9): e0256708. |
| 13 | TETIK VARDARLı A, DÜZGÜN Z, ERDEM C,et al. Matrine induced G0/G1 arrest and apoptosis in human acute T-cell lymphoblastic leukemia (T-ALL) cells[J]. Bosn J Basic Med Sci, 2018, 18(2): 141-149. |
| 14 | GAO Y, LI H, HAN Q, et al. Overexpression of DUSP6 enhances chemotherapy-resistance of ovarian epithelial cancer by regulating the ERK signaling pathway[J]. J Cancer, 2020, 11(11): 3151-3164. |
| 15 | EREKAT N S. Programmed cell death in diabetic nephropathy: a review of apoptosis, autophagy, and necroptosis[J]. Med Sci Monit, 2022, 28: e937766. |
| 16 | XI H Y, WANG S, WANG B B, et al. The role of interaction between autophagy and apoptosis in tumorigenesis (Review)[J].Oncol Rep,2022,48(6):208. |
| 17 | DEHKORDI M H, MUNN R G K, FEARNHEAD H O.Non-canonical roles of apoptotic caspases in the nervous system[J].Front Cell Dev Biol,2022,10: 840023. |
| 18 | WANG M S, CHEN L, XIONG Y Q, et al. Iron oxide magnetic nanoparticles combined with actein suppress non-small-cell lung cancer growth in a p53-dependent manner[J]. Int J Nanomedicine, 2017, 12: 7627-7651. |
| 19 | ULUTAŞ P A, KıRAL F, ULUTAŞ B, et al. Cytotoxic and apoptotic effect of nanoclinoptilolite on canine osteosarcoma cell lines[J]. J Vet Res, 2020, 64(4): 589-596. |
| 20 | LI M, YAN T T, CAI Y Q, et al. Expression of matrix metalloproteinases and their association with clinical characteristics of solid tumors[J].Gene,2023,850: 146927. |
| 21 | AUGOFF K, HRYNIEWICZ-JANKOWSKA A, TABOLA R, et al. MMP9: a tough target for targeted therapy for cancer[J]. Cancers, 2022, 14(7): 1847. |
| 22 | ESCALONA R M, KANNOURAKIS G, FINDLAY J K,et al. Expression of TIMPs and MMPs in ovarian tumors, ascites, ascites-derived cells, and cancer cell lines: characteristic modulatory response before and after chemotherapy treatment[J].Front Oncol,2021,11:796588. |
| 23 | REGGIANI F, LABANCA V, MANCUSO P, et al. Adipose progenitor cell secretion of GM-CSF and MMP9 promotes a stromal and immunological microenvironment that supports breast cancer progression[J]. Cancer Res, 2017, 77(18): 5169-5182. |
| 24 | CANDIDO S, TOMASELLO B, LAVORO A, et al. Bioinformatic analysis of the LCN2-SLC22A17-MMP9 network in cancer: the role of DNA methylation in the modulation of tumor microenvironment[J]. Front Cell Dev Biol, 2022, 10: 945586. |
| 25 | LIU H, HU G H, WANG Z Y, et al. circPTCH1 promotes invasion and metastasis in renal cell carcinoma via regulating miR-485-5p/MMP14 axis[J]. Theranostics, 2020, 10(23): 10791-10807. |
| [1] | Xiao ZHOU,Haitao DAI,Yunshan DING,Linjie ZHANG,Nan WU. Network pharmacology analysis and in vitro experimental validation of anticancer effect of grape seed proanthocyanidins against oral squamous cell carcinoma [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 651-662. |
| [2] | Yang LI,Shiyang LI,Hongmei ZHANG,Qianqian LIU,Yubing CHEN. Effect of NGFR gene expression differences on promotion of apoptosis of squamous cell carcinoma and adenocarcinoma cells by PD-1 inhibitor-activated T lymphocytes [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 680-693. |
| [3] | Qiaotong REN,Weihua WU,Xingxiang WANG,Shichao WANG,Yipeng CHENG,Chun LI. Effect of interleukin-17 recepter B gene silencing on proliferation, invasion and apoptosis of lung adenocarcinoma A549 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 738-745. |
| [4] | Qiuping SU,Lei XING,Wei ZHANG,Shan JIANG,Yangyang ZHAO,Fangfang CHEN. Research progress in anti-tumor mechanism of berberine and application of its novel nano-delivery system in tumor therapy [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 863-871. |
| [5] | Jie YU,Zongkang WANG,Xun LIU,Yanan YANG,Jin TAN. Effect of miR-153-3p/PGC-1α axis on apoptosis of oral squamous cell carcinoma cells by modulation of mitochondrial apoptosis pathway [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 348-358. |
| [6] | Li ZHAI,Meng CHEN,Jianbo LUO,Aili ZHANG,Liangxiao WANG,Ying WEI,Xi ZHANG. Targeting relationship between miR-214-3p and EZH2 and its effects on proliferation, invasion, and apoptosis of ovarian cancer SKOV3 cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 460-468. |
| [7] | Hong LI,Panpan YU,Zouyu ZHAO,Chongfeng SUN,Hui QIAO,Ping YANG. Expression of GSTO1 in ovarian cancer tissue and effect of N-glycosylation site mutations on biological behaviors of epithelial ovarian cancer cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 469-482. |
| [8] | Yunshan DING,Haitao DAI,Min CHEN,Xiaohui HAO,Xiao ZHOU,Nan WU. Effect of silencing TRPV2 gene and cannabidiol on biological behaviors of oral squamous cell carcinoma CAL-27 cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 143-151. |
| [9] | Yaping LI,Chunyan TAN,Lujie ZHAO,Jiayi ZHAO,Ting LI,Xiao YANG,Xiaoyun YANG. Inductive effect of lysophosphatidic acid combined with 6-hydroxydopamine on apoptosis of SH-SY5Y cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 152-161. |
| [10] | Jiaxin WANG,Junwen MAO,Xuan ZHANG. Expression of natural autoantibodies against apoptosis inhibitory genes in plasma of patients with hepatocellular carcinoma and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 228-235. |
| [11] | Huaimin LIANG,Jiacheng JIN,Wenhua CHEN,Yuyao LI,Hangyu WANG,Ke ZHANG,Jinhui WANG. UPLC-Q-TOF/MS and network pharmacology analysis and experimental verification based on potential active ingredients and mechanisms of medicinal Mulberry Leaves in anti-acute kidney injury [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 56-69. |
| [12] | Shanshan SUN,Mei LU,Xinfu GAO,LYu Guangyao,Baolei Zhao,LYu Wenwen. Inhibitory effect of Bradykinin 1 receptor antagonist ELN441958 on proliferation of HepG2 cells by regulating Akt/FoxO3a signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 70-80. |
| [13] | Xiaohan YAO,Mingchen YAO,Zhiqing WANG,Heyang LI,Yan YAN,Ningjing LEI. Effect of silencing GPR139 gene on proliferation, apoptosis and autophagy of breast cancer cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 1-9. |
| [14] | Pingsheng ZHU,Sitang GE,Lugen ZUO,Deli CHEN,Yangyang ZHANG. Effect of miR-325-3p targeting PRELID1 gene in regulation of EMT pathway on invasion and migration of colon cancer cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1185-1193. |
| [15] | Han XUE,Yuxin FAN,Ting ZHANG,Zhimin LI,Mingge HUO,Xingang GUAN. Preparation of nanodrug PTX2 NPs and its killing effect on human lung cancer A549 cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1260-1266. |