Journal of Jilin University(Medicine Edition) ›› 2026, Vol. 52 ›› Issue (3): 651-662.doi: 10.13481/j.1671-587X.20260308
• Research in basic medicine • Previous Articles Next Articles
Xiao ZHOU,Haitao DAI,Yunshan DING,Linjie ZHANG,Nan WU(
)
Received:2025-09-08
Accepted:2025-11-02
Online:2026-05-28
Published:2026-06-08
Contact:
Nan WU
E-mail:195773220@qq.com
CLC Number:
Xiao ZHOU,Haitao DAI,Yunshan DING,Linjie ZHANG,Nan WU. Network pharmacology analysis and in vitro experimental validation of anticancer effect of grape seed proanthocyanidins against oral squamous cell carcinoma[J].Journal of Jilin University(Medicine Edition), 2026, 52(3): 651-662.
Tab.1
Primer sequences of PCR"
| Gene | Primer sequences(5'-3') | |
|---|---|---|
| HSP90AA1 | F | AGGAGGTTGAGACGTTCGC |
| R | AGAGTTCGATCTTGTTTGTTCGG | |
| Bcl-2 | F | TTTGTGGAACTGTACGGCCC |
| R | TCACTTGTGGCCCAGATAGG | |
| PTGS2 | F | CAAATTGCTGGCAGGGTTGCT |
| R | CTGGCCGAGGCTTTTCTACC | |
| NFKB1 | F | GAAGCACGAATGACAGAGGC |
| R | GCTTGGCGGATTAGCTCTTTT | |
| GAPDH | F | GGAGCGAGATCCCTCCAAAAT |
| R | GGCTGTTGTCATACTTCTCATGG |
Tab.2
Survival rates of cells in various groups"
| Group | SCC-15 cells | CAL-27 cells | ||||||
|---|---|---|---|---|---|---|---|---|
| (t/h) 12 | 24 | 48 | 72 | (t/h) 12 | 24 | 48 | 72 | |
Control GSPE (mg·L-1) | 100.00±3.90 | 100.00±2.07 | 100.00±10.92 | 100.00±5.91 | 100.00±0.78 | 100.00±1.88 | 100.00±2.62 | 100.00±1.33 |
| 5 | 93.41±9.59 | 93.12±1.66** | 82.00±2.66* | 92.31±6.27 | 98.85±6.29 | 77.67±1.28** | 73.91±1.06** | 66.29±0.56** |
| 10 | 78.82±3.24** | 59.40±0.68** | 61.23±2.50** | 67.62±5.08** | 87.53±3.95* | 55.92±0.69** | 36.76±0.55** | 39.19±0.23** |
| 20 | 47.34±1.41** | 10.80±0.16** | 9.37±0.46** | 3.96±0.30** | 67.94±1.18** | 23.26±0.37** | 12.76±0.38** | 14.49±0.24** |
Tab.3
Scratch healing rates of cells in various groups after treatment 0,12, and 24 h"
| Group | Scratch healing rate of SCC-15 cells | Scratch healing rate of CAL-27 cells | ||
|---|---|---|---|---|
| Time(t/h) 12 | 24 | (t/h) 12 | 24 | |
Control GSPE (mg·L-1) | 59.68±2.13 | 73.64±4.02 | 33.87±3.90 | 74.58±0.72 |
| 5 | 30.34±1.72** | 37.31±3.06** | 26.94±2.72* | 61.14±1.64** |
| 10 | 16.28±2.56** | 26.62±3.63** | 12.29±0.49** | 21.33±3.08** |
| 20 | 4.65±2.70** | 10.03±2.53** | 2.30±0.74** | 4.23±0.48** |
| [1] | SIEGEL R L, KRATZER T B, WAGLE N S, et al. Cancer statistics, 2026[J]. CA Cancer J Clin, 2026, 76: e70043. |
| [2] | LIU W, WANG J, ZHANG C P, et al. Curcumin nanoemulsions inhibit oral squamous cell carcinoma cell proliferation by PI3K/Akt/mTOR suppression and miR-199a upregulation: a preliminary study[J]. Oral Dis, 2023, 29(8): 3183-3192. |
| [3] | LIU T, LONG T, LI H S. Curcumin suppresses the proliferation of oral squamous cell carcinoma through a specificity protein 1/nuclear factor-κB-dependent pathway[J]. Exp Ther Med, 2021, 21(3): 202. |
| [4] | CHEN L, XIA J S, WU J H, et al. Resveratrol inhibits oral squamous cell carcinoma cells proliferation while promoting apoptosis through inhibition of CBX7 protein[J]. Environ Toxicol, 2020, 35(11): 1234-1240. |
| [5] | RAMSRIDHAR S, RAJKUMAR C, VEERARAGHAVAN V P, et al. From cell lines to animal models: “plant- derived chemotherapeutics unlocking new frontiers against oral squamous cell carcinoma”-a comprehensive systematic review[J]. Discov Oncol, 2025, 16(1): 340. |
| [6] | GUPTA M, DEY S, MARBANIANG D, et al. Grape seed extract: having a potential health benefits[J]. J Food Sci Technol, 2020, 57(4): 1205-1215. |
| [7] | HABIB H M, EL-FAKHARANY E M, KHEADR E, et al. Grape seed proanthocyanidin extract inhibits DNA and protein damage and labile iron, enzyme, and cancer cell activities[J]. Sci Rep, 2022, 12(1): 12393. |
| [8] | BAGCHI M, KUSZYNSKI C A, BALMOORI J, et al. Protective effects of antioxidants against smokeless tobacco-induced oxidative stress and modulation of Bcl-2 and p53 genes in human oral keratinocytes[J]. Free Radic Res, 2001, 35(2): 181-194. |
| [9] | JOHNSON D E, BURTNESS B, LEEMANS C R, et al. Head and neck squamous cell carcinoma[J]. Nat Rev Dis Primers, 2020, 6(1): 92. |
| [10] | MENG X, LOU Q Y, YANG W Y, et al. The role of non-coding RNAs in drug resistance of oral squamous cell carcinoma and therapeutic potential[J]. Cancer Commun (Lond), 2021, 41(10): 981-1006. |
| [11] | RAUF A, IMRAN M, ABU-IZNEID T, et al. Proanthocyanidins: a comprehensive review[J]. Biomedecine Pharmacother, 2019, 116: 108999. |
| [12] | GUO F M, HU Y H, NIU Q, et al. Grape seed proanthocyanidin extract inhibits human esophageal squamous cancerous cell line ECA109 via the NF-κB signaling pathway[J]. Mediators Inflamm, 2018, 2018: 3403972. |
| [13] | WANG L H, ZHAN J C, HUANG W D. Grape seed proanthocyanidins induce apoptosis and cell cycle arrest of HepG2 cells accompanied by induction of the MAPK pathway and NAG-1[J]. Antioxidants (Basel), 2020, 9(12): 1200. |
| [14] | YANG N G, GAO J, CHENG X, et al. Grape seed proanthocyanidins inhibit the proliferation, migration and invasion of tongue squamous cell carcinoma cells through suppressing the protein kinase B/nuclear factor-κB signaling pathway[J]. Int J Mol Med, 2017, 40(6): 1881-1888. |
| [15] | XUE C, LI G L, LU J, et al. Crosstalk between circRNAs and the PI3K/AKT signaling pathway in cancer progression[J]. Sig Transduct Target Ther, 2021, 6(1): 400. |
| [16] | ZHANG M Y, MA L J, JIANG L, et al. Paeoniflorin protects against cisplatin-induced acute kidney injury through targeting Hsp90AA1-Akt protein-protein interaction[J]. J Ethnopharmacol, 2023, 310: 116422. |
| [17] | ZHANG D M, WANG A F, FENG J P, et al. Ginsenoside Rg5 induces apoptosis in human esophageal cancer cells through the phosphoinositide-3 kinase/protein kinase B signaling pathway[J]. Mol Med Rep, 2019, 19(5): 4019-4026. |
| [18] | NASRY W H S, RODRIGUEZ-LECOMPTE J C, MARTIN C K. Role of COX-2/PGE2 mediated inflammation in oral squamous cell carcinoma[J]. Cancers, 2018, 10(10): 348. |
| [19] | FREJBORG E, SALO T, SALEM A. Role of cyclooxygenase-2 in head and neck tumorigenesis[J]. Int J Mol Sci, 2020, 21(23): 9246. |
| [20] | KAMAL M V, DAMERLA R R, PARIDA P, et al. Expression of PTGS2 along with genes regulating VEGF signalling pathway and association with high-risk factors in locally advanced oral squamous cell carcinoma[J]. Cancer Med, 2024, 13(3): e6986. |
| [21] | YANG T Q, CHEN M, WANG Y Q, et al. Nuclear factor-kappa B1 inhibits early apoptosis of glioma cells by promoting the expression of Bcl-2[J]. Onco Targets Ther, 2017, 10: 4305-4313. |
| [22] | LIU H, ZHENG J, REN Z D, et al. miR-107 modulates EMT progression of OSCC by targeting SNCG and inhibiting the ERK/NF-κB signaling pathways[J]. J Transl Med, 2025, 23(1): 881. |
| [1] | Qiaotong REN,Weihua WU,Xingxiang WANG,Shichao WANG,Yipeng CHENG,Chun LI. Effect of interleukin-17 recepter B gene silencing on proliferation, invasion and apoptosis of lung adenocarcinoma A549 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(3): 738-745. |
| [2] | Jie YU,Zongkang WANG,Xun LIU,Yanan YANG,Jin TAN. Effect of miR-153-3p/PGC-1α axis on apoptosis of oral squamous cell carcinoma cells by modulation of mitochondrial apoptosis pathway [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 348-358. |
| [3] | Yao ZHENG,Mingxia FU,Weichen WANG,Weiwei CHEN,Yuchen HAN,Yu BAI,Jiajia AN. Effect of sodium selenite on biological behaviors of breast cancer doxorubicin-resistant MCF-7/ADR cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 410-417. |
| [4] | Li ZHAI,Meng CHEN,Jianbo LUO,Aili ZHANG,Liangxiao WANG,Ying WEI,Xi ZHANG. Targeting relationship between miR-214-3p and EZH2 and its effects on proliferation, invasion, and apoptosis of ovarian cancer SKOV3 cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 460-468. |
| [5] | Hong LI,Panpan YU,Zouyu ZHAO,Chongfeng SUN,Hui QIAO,Ping YANG. Expression of GSTO1 in ovarian cancer tissue and effect of N-glycosylation site mutations on biological behaviors of epithelial ovarian cancer cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(2): 469-482. |
| [6] | Yunshan DING,Haitao DAI,Min CHEN,Xiaohui HAO,Xiao ZHOU,Nan WU. Effect of silencing TRPV2 gene and cannabidiol on biological behaviors of oral squamous cell carcinoma CAL-27 cells [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 143-151. |
| [7] | Yan ZHAO,Huawei WU. Inhibitory effect of inhibition of miR-17-5p on proliferation of spinal cord astrocytes of rats induced by scratch injury through targeting Mfn2 expression [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 81-92. |
| [8] | Xiaohan YAO,Mingchen YAO,Zhiqing WANG,Heyang LI,Yan YAN,Ningjing LEI. Effect of silencing GPR139 gene on proliferation, apoptosis and autophagy of breast cancer cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2026, 52(1): 1-9. |
| [9] | Sifan FENG,Yunfeng LI,Jiaying WANG,Fubin MA,Yan WANG. Effects of heme-binding protein 1 gene knockdown on proliferation, migration, and inflammatory response of microglia BV2 and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1532-1541. |
| [10] | Lulu FU,Yinggang ZOU,Xiaoyu ZHENG,Xueying ZHANG,Jingshun ZHANG,Min WANG,Qiang ZHANG,Lianwen ZHENG. Expression of placenta expressed transcription factor 1 in ovarian tissue of polycystic ovary syndrome rats and its effect on proliferation of rat ovarian granulosa cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1177-1184. |
| [11] | Pingsheng ZHU,Sitang GE,Lugen ZUO,Deli CHEN,Yangyang ZHANG. Effect of miR-325-3p targeting PRELID1 gene in regulation of EMT pathway on invasion and migration of colon cancer cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1185-1193. |
| [12] | Wenxuan LI,Minru ZONG. Research progress in role of migration of Schwann cells in repairment of peripheral nerve injury [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 1137-1144. |
| [13] | Zhongjun SHEN,Yao ZHAO,Mingbo JIA,Liyan ZHAO. Research progress in effects of hypoxia-inducible factors on cell migration and invasion during epithelial-mesenchymal transition in glioma cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 1145-1154. |
| [14] | Yixuan GAO,Peng WANG,Silong ZHANG,Ruijuan GAO,Yingfang MA,Keke ZHANG,Dan FENG,Zongqi HUANG,Ketao MA,Li LI,Junqiang SI. Inhibitory effect of safranal on proliferation, migration and phenotypic transformation of vascular smooth muscle cells of rats induced by high glucose in vitro [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 948-957. |
| [15] | Xiaoshuang HE,Lina XU,Mei CUI,Yu ZHAO,Bei WANG,Zheng HUANG,Yuchao WANG,Wenyan XIN,Chao WU. Effects of lncRNA DUXAP8 in lung cancer A549 cells-derived exosomes on lung cancer cell growth and its mechnism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 958-967. |