Journal of Jilin University(Medicine Edition) ›› 2025, Vol. 51 ›› Issue (6): 1452-1463.doi: 10.13481/j.1671-587X.20250602
• Research in basic medicine • Previous Articles
Xiaoqian TANG,Shengcong WEN,Zhenya DONG,Jingyi CHEN,Yu CAO,Yunhua ZHANG(
)
Received:2024-11-07
Accepted:2025-02-12
Online:2025-11-28
Published:2025-12-15
Contact:
Yunhua ZHANG
E-mail:yunhuazhang@shzu.edu.cn
CLC Number:
Xiaoqian TANG,Shengcong WEN,Zhenya DONG,Jingyi CHEN,Yu CAO,Yunhua ZHANG. Improvement effect of engineered exosomes delivering ANGPTL6 mRNA on liver fibrosis in mice[J].Journal of Jilin University(Medicine Edition), 2025, 51(6): 1452-1463.
Tab.1
Primer sequences of RT-qPCR"
| Primer | Sequences (5'-3') | NCBI Refseq |
|---|---|---|
| ANGPTL6 | Forward: CTGGGCCGTCGTGTAGTAG | NM_145154.2 |
| Reverse: CAGTCCTCTAGGAGTATCAGCAG | ||
| α-SMA | Forward: GTCCCAGACATCAGGGAGTAA | NM_007392.3 |
| Reverse: TCGGATACTTCAGCGTCAGGA | ||
| Col1a1 | Forward: GCTCCTCTTAGGGGCCACT | NM_007742.4 |
| Reverse: CCACGTCTCACCATTGGGG | ||
| TGF-β1 | Forward: CTCCCGTGGCTTCTAGTGC | NM_011577.2 |
| Reverse: GCCTTAGTTTGGACAGGATCTG | ||
| TIMP-1 | Forward: GCAACTCGGACCTGGTCATAA | NM_001044384.2 |
| Reverse: CGGCCCGTGATGAGAAACT | ||
| β-actin | Forward: GGCTGTATTCCCCTCCATCG | NM_007393.5 |
| Reverse: CCAGTTGGTAACAATGCCATGT |
| [1] | ROEHLEN N, CROUCHET E, BAUMERT T F. Liver fibrosis: mechanistic concepts and therapeutic perspectives[J]. Cells, 2020, 9(4): 875. |
| [2] | PAROLA M, PINZANI M. Liver fibrosis: Pathophysiology, pathogenetic targets and clinical issues[J]. Mol Aspects Med, 2019, 65: 37-55. |
| [3] | WANG Y K, WANG M Q, LIU C R, et al. Global burden of liver cirrhosis 1990-2019 and 20 years forecast: results from the global burden of disease study 2019[J]. Ann Med, 2024, 56(1): 2328521. |
| [4] | MOHAMMED O S, ATTIA H G, MOHAMED B M S A, et al. Current investigations for liver fibrosis treatment: between repurposing the FDA-approved drugs and the other emerging approaches[J]. J Pharm Pharm Sci, 2023, 26: 11808. |
| [5] | ZHANG C Y, LIU S, YANG M. Treatment of liver fibrosis: Past, current, and future[J]. World J Hepatol, 2023, 15(6): 755-774. |
| [6] | OIKE Y, YASUNAGA K, ITO Y, et al. Angiopoietin-related growth factor (AGF) promotes epidermal proliferation, remodeling, and regeneration[J]. Proc Natl Acad Sci U S A, 2003, 100(16): 9494-9499. |
| [7] | OIKE Y, AKAO M, YASUNAGA K, et al. Angiopoietin-related growth factor antagonizes obesity and insulin resistance[J]. Nat Med, 2005, 11(4): 400-408. |
| [8] | HOSTETTLER I C, O’CALLAGHAN B, BUGIARDINI E, et al. ANGPTL6 genetic variants are an underlying cause of familial intracranial aneurysms[J]. Neurology, 2021, 96(6): e947-e955. |
| [9] | WANG Z H, TANG M Z, RONG Y, et al. ANGPTL6 can be used as potential biomarkers for the diagnosis and prognosis of thyroid cancer[J]. Asian J Surg, 2024, 47(7): 3079-3081. |
| [10] | QADDOUMI M G, ALANBAEI M, HAMMAD M M, et al. Investigating the role of myeloperoxidase and angiopoietin-like protein 6 in obesity and diabetes[J]. Sci Rep, 2020, 10(1): 6170. |
| [11] | ABELS E R, BREAKEFIELD X O. Introduction to extracellular vesicles: biogenesis, RNA cargo selection, content, release, and uptake[J]. Cell Mol Neurobiol, 2016, 36(3): 301-312. |
| [12] | RAFIEEZADEH D. Extracellular vesicles and their therapeutic applications: a review article (part 2)[J]. Int J Physiol Pathophysiol Pharmacol, 2024, 16(4): 81-88. |
| [13] | FAN W G, LIU T H, CHEN W, et al. ECM1 prevents activation of transforming growth factor β, hepatic stellate cells, and fibrogenesis in mice[J]. Gastroenterology, 2019, 157(5): 1352-1367.e13. |
| [14] | HORN P, TACKE F. Metabolic reprogramming in liver fibrosis[J]. Cell Metab, 2024, 36(7): 1439-1455. |
| [15] | KAMM D R, MCCOMMIS K S. Hepatic stellate cells in physiology and pathology[J]. J Physiol, 2022, 600(8): 1825-1837. |
| [16] | ZHANG M F, SERNA-SALAS S, DAMBA T, et al. Hepatic stellate cell senescence in liver fibrosis: Characteristics, mechanisms and perspectives[J]. Mech Ageing Dev, 2021, 199: 111572. |
| [17] | KONG M, ZHOU J J, KANG A Q, et al. Histone methyltransferase Suv39h1 regulates hepatic stellate cell activation and is targetable in liver fibrosis[J]. Gut, 2024, 73(5): 810-824. |
| [18] | DING J, XU C, XU M, et al. Emerging role of engineered exosomes in nonalcoholic fatty liver disease[J]. World J Hepatol, 2023, 15(3): 386-392. |
| [19] | KOJIMA R, BOJAR D, RIZZI G, et al. Designer exosomes produced by implanted cells intracerebrally deliver therapeutic cargo for Parkinson’s disease treatment[J]. Nat Commun, 2018, 9(1): 1305. |
| [20] | SAITO H, KOBAYASHI T, HARA T, et al. Synthetic translational regulation by an L7Ae-kink-turn RNP switch[J]. Nat Chem Biol, 2010, 6(1): 71-78. |
| [21] | LIANG Y J, DUAN L, LU J P, et al. Engineering exosomes for targeted drug delivery[J]. Theranostics, 2021, 11(7): 3183-3195. |
| [22] | URABE F, KOSAKA N, ITO K, et al. Extracellular vesicles as biomarkers and therapeutic targets for cancer[J]. Am J Physiol Cell Physiol, 2020, 318(1): C29-C39. |
| [23] | AMERNIA B, MOOSAVY S H, BANOOKH F, et al. FIB-4, APRI, and AST/ALT ratio compared to FibroScan for the assessment of hepatic fibrosis in patients with non-alcoholic fatty liver disease in Bandar Abbas, Iran[J]. BMC Gastroenterol, 2021, 21(1): 453. |
| [24] | DUAN B W, LIU Y J, LI X N, et al. An autologous macrophage-based phenotypic transformation-collagen degradation system treating advanced liver fibrosis[J]. Adv Sci, 2024, 11(7): 2306899. |
| [25] | XUE X Y, ZHAO X T, WANG J, et al. Carthami flos extract against carbon tetrachloride-induced liver fibrosis via alleviating angiogenesis in mice[J]. Phytomedicine, 2023, 108: 154517. |
| [26] | XU S X, CHEN Y E, MIAO J D, et al. Esculin inhibits hepatic stellate cell activation and CCl(4)-induced liver fibrosis by activating the Nrf2/GPX4 signaling pathway[J]. Phytomedicine, 2024, 128: 155465. |
| [27] | WANG C, ZHANG S L, LI Y Z, et al. Phillygenin inhibits TGF-β1-induced hepatic stellate cell activation and inflammation: regulation of the bax/bcl-2 and Wnt/β-catenin pathways[J]. Inflammation, 2024, 47(4): 1403-1422. |
| [28] | MEDEIROS T, SARAIVA G N, MORAES L A, et al. Liver fibrosis improvement in chronic hepatitis C after direct acting-antivirals is accompanied by reduced profibrogenic biomarkers-a role for MMP-9/TIMP-1[J]. Dig Liver Dis, 2020, 52(10): 1170-1177. |
| [29] | JI Y, DUAN Y L, LI Y Y, et al. A long-acting FGF21 attenuates metabolic dysfunction-associated steatohepatitis-related fibrosis by modulating NR4A1-mediated Ly6C phenotypic switch in macrophages[J]. Br J Pharmacol, 2024, 181(16): 2923-2946. |
| [30] | YANG J, CHEN L, ZHAO S S, et al. FGF21-dependent alleviation of cholestasis-induced liver fibrosis by sodium butyrate[J]. Front Pharmacol, 2024, 15: 1422770. |
| [31] | KANG S G, YI H S, CHOI M J, et al. ANGPTL6 expression is coupled with mitochondrial OXPHOS function to regulate adipose FGF21[J]. J Endocrinol, 2017, 233(1): 105-118. |
| [1] | Yi ZHAO,Bing ZHOU,Huirui QIU,Xuan LI,Xiangli CUI. Improvement effect of lovastatin on hyperlipidemia-induced liver injury in rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(5): 1155-1164. |
| [2] | Huixian XU,Hui XU,Jishu QUAN,Feng ZHENG. Inhibitory effect of iridoid glycosides from Boschniakia rossica on hepatic preneolasia of rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 887-895. |
| [3] | Kaiqi NIU,He CHANG,Guangfu LYU,Pengyu ZHENG,Xueting CHI,Jia ZHOU,Yuchen WANG,Xiaowei HUANG. Inhibitory effect of astragaloside Ⅳ on cisplatin-induced liver injury in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 370-377. |
| [4] | Chaohe ZHANG,Xinwei ZHANG,Xiangfeng WANG. Protective effect of Pien-Tze-Huang on acetaminophen-induced liver injury and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(1): 105-114. |
| [5] | Yi LONG,Ziyi YOU,Xiuying TAN,Rou ZHANG,Yuhan ZHANG,Lina YANG. Protective effect of sodium butyrate on acute liver injury in mice induced by lipopolysaccharide combined with D-galactosamine and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1614-1620. |
| [6] | Lingyao XU,Shutang WEI,Yong DONG,Zhenglu SUN,Junbo ZHAO,Dazheng HAN. Regulatory effect of lncRNA MALAT1 on activation of hepatic stellate cell and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 697-705. |
| [7] | Jing GUAN,Shen HA,Hao YUAN,Ying CHEN,Pengju LIU,Zhi LIU,Shuang JIANG. Protective effect of Modified Xiao-Xian-Xiong Decoction on liver injury in rats with type 2 diabete mellitus and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 608-616. |
| [8] | Mingliu GU,Fengyuan LIN,Xuefeng WU,Jianing ZHOU,Xuechun LU,Peige DU,Liping AN. Improvement effect of Phellinus igniarius acidic polysaccharide on liver fibrosis induced by bile duct ligation in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(5): 1167-1174. |
| [9] | Yang ZHENG,Jiahui WANG,Yue PENG,Xianling YUAN,Lei WANG,Tiejian ZHAO. Influence of curcumol in structure of liver sinusoidal endothelial cells of mice and its inhibitiory effect on intrahepatic angiogenesis [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1124-1130. |
| [10] | Zhouguang WU,Bin WANG,Zhen CHENG,Wenjie ZHANG,Taoyan ZUO,Siqi CHEN,Jingru FU. Analysis on correlation of GPC3 and α-SMA expressions with liver function-related indexes in liver tissue of children with biliary atresia [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1237-1243. |
| [11] | Rongjun JIA,Liman MA,Lihua LI. Protective effect of calcitriol on hepatic fibrosis induced by bile duct ligation in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(2): 257-264. |
| [12] | YANG Fan, LI Lihua. Effect of vitamin D receptor activation on hepatic fibrosis induced by bile duct ligation in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2020, 46(04): 722-727. |
| [13] | YAO Hongyue, LIU Xinyu, LIU Wanzhu. Protective effect of panaxdiol on acute liver damage of rats induced by carbon tetrachloride and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2019, 45(03): 479-483. |
| [14] | LIANG Shuang, TAO Xue, PAN Yan, YUAN Rongshuang, LI He, SUN Jinghui, JU Wenbo, CHEN Jianguang, WANG Chunmei. Comparison of contents and effects of lignans from 4 strains of Schisandra chinensis [J]. Journal of Jilin University(Medicine Edition), 2019, 45(02): 300-306. |
| [15] | BAI Jie, JI Wenjing, DING Yongnian, PENG Yuanyuan, CHEN Yuanwen. Changes of levelsof endogenous AcSDKP and its regulatory factors in liver tissue of model rats with liver fibrosis induced by bile duct ligation [J]. Journal of Jilin University(Medicine Edition), 2018, 44(05): 999-1004. |
|
||