lncRNA H19和IGF2基因在乳腺癌组织中的表达水平及印记状态

doi:10.13481/j.1671-587X.20240425

Abstract

Abstract:

Objective To study the expression levels of long non-coding RNA （lncRNA） H19 and insulin-like growth factor 2 （IGF2） genes in breast cancer tissue， and to analyze their imprinting status. Methods Real-time fluorescence quantitative PCR （RT-qPCR） method was used to detect the expression levels of H19 and IGF2 mRNA in breast cancer tissue and adjacent tissue， and the differences in the expressions of H19 and IGF2 mRNA in breast cancer tissue and adjacent tissue were analyzed； single nucleotide polymorphism （SNP） was used to distinguish the allele expression status （homozygous or heterozygous）. For heterozygous IGF2 （ApaⅠ site） or H19 （AluⅠ site） in genomic DNA， imprinting analysis was used to detect the imprinting status of H19 and IGF2 in breast cancer tissue， that were maintenance of imprinting （MOI） or loss of imprinting （LOI）； the relationship between the expressions of H19 and IGF2 and molecular subtypes in breast cancer tissue were also analyzed. Results The RT-qPCR results showed that the expression levels of H19 and IGF2 mRNA in breast cancer tissue were higher than those in adjacent tissue （P<0.01）. There was a positive correlation between the expression levels of H19 mRNA and IGF2 mRNA （r=0.567， P<0.01）. Compared with adjacent tissue， the expression levels of H19 mRNA in cancer tissue of the breast cancer patients with various molecular subtypes were increased （P<0.05 or P<0.01）. LOI was observed in both H19 and IGF2 in breast cancer tissue， and the incidence of IGF2 LOI was 36.7%， which was higher than that of H19 LOI（4.3%）. The RT-qPCR results showed that the expression level of IGF2 mRNA in breast cancer tissue in IGF2 LOI group was significantly higher than that in IGF2 MOI group （P<0.01）. Conclusion The expression levels of H19 and IGF2 mRNA in breast cancer tissue are significantly higher than those in adjacent tissue. The incidence of IGF2 LOI is higher than that of H19 LOI， and IGF2 LOI may be one of the key factors in the pathogenesis of breast cancer.

Key words: Breast neoplasm, Long chain non-coding RNA H19, Insulin-like growth factor 2, Loss of imprinting, Single nucleotide polymorphism

CLC Number:

R737.9

Xue WEI,Xue WEN,Xiao XIE,Yueyuan WANG,Dan HUANG,Ming YANG. Expression levels and imprinting status of lncRNA H19 and IGF2 genes in breast cancer tissue[J].Journal of Jilin University(Medicine Edition), 2024, 50(4): 1109-1115.

Figures/Tables 9

Tab.1

Tab. 2

Fig. 1

Fig. 2

Tab. 3

Tab. 4

Fig. 3

Tab. 5

Fig. 4

References 22

1	SUNG H， FERLAY J， SIEGEL R L， et al. Global cancer statistics 2020： GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries［J］. CA Cancer J Clin， 2021， 71（3）： 209-249.
2	BREAST CANCER ASSOCIATION CONSORTIUM， MAVADDAT N， DORLING L， et al. Pathology of tumors associated with pathogenic germline variants in 9 breast cancer susceptibility genes［J］. JAMA Oncol， 2022， 8（3）： e216744.
3	TUCCI V， ISLES A R， KELSEY G， et al. Genomic imprinting and rhysiological processes in mammals［J］. Cell， 2019， 176（5）： 952-965.
4	WANG J， SUN J Y， YANG F. The role of long non-coding RNA H19 in breast cancer［J］. Oncol Lett， 2020， 19（1）： 7-16.
5	LIVINGSTONE C. IGF2 and cancer［J］. Endocr Relat Cancer， 2013， 20（6）： R321-R339.
6	PEPERSTRAETE E， LECERF C， COLLETTE J， et al. Enhancement of breast cancer cell aggressiveness by lncRNA H19 and its mir-675 derivative： insight into shared and different actions［J］. Cancers， 2020， 12（7）： 1730.
7	CHAO W， D’AMORE P A. IGF2： epigenetic regulation and role in development and disease［J］. Cytokine Growth Factor Rev， 2008， 19（2）： 111-120.
8	RATAJCZAK M Z. IGF2-H19， an imprinted tandem gene， is an important regulator of embryonic development， a guardian of proliferation of adult pluripotent stem cells， a regulator of longevity， and a ‘passkey’ to cancerogenesis［J］. Folia Histochem Cytobiol， 2012， 50（2）： 171-179.
9	GAILHOUSTE L， LIEW L C， YASUKAWA K， et al. MEG3-derived miR-493-5p overcomes the oncogenic feature of IGF2-miR-483 loss of imprinting in hepatic cancer cells［J］. Cell Death Dis， 2019， 10（8）： 553.
10	WANG Y， ZHOU P H， LI P， et al. Long non-coding RNA H19 regulates proliferation and doxorubicin resistance in MCF-7 cells by targeting PARP1［J］. Bioengineered， 2020， 11（1）： 536-546.
11	WEI Y G， LIU Z Y， FANG J H. H19 functions as a competing endogenous RNA to regulate human epidermal growth factor receptor expression by sequestering let-7c in gastric cancer［J］. Mol Med Rep， 2018， 17（2）： 2600-2606.
12	ZHOU W， YE X L， XU J， et al. The lncRNA H19 mediates breast cancer cell plasticity during EMT and MET plasticity by differentially sponging miR-200b/c and let-7b［J］. Sci Signal， 2017， 10（483）： eaak9557.
13	LIU Y， SHARMA S， WATABE K. Roles of lncRNA in breast cancer［J］. Front Biosci， 2015， 7（1）： 94-108.
14	SUN H， WANG G， PENG Y， et al. H19 lncRNA mediates 17β-estradiol-induced cell proliferation in MCF-7 breast cancer cells［J］. Oncol Rep， 2015， 33（6）： 3045-3052.
15	BASAK P， CHATTERJEE S， WEGER S， et al. Estrogen regulates luminal progenitor cell differentiation through H19 gene expression［J］. Endocr Relat Cancer， 2015， 22（4）： 505-517.
16	BERTEAUX N， LOTTIN S， MONTÉ D， et al. H19 mRNA-like noncoding RNA promotes breast cancer cell proliferation through positive control by E2F1［J］. J Biol Chem， 2005， 280（33）： 29625-29636.
17	YU H， ROHAN T. Role of the insulin-like growth factor family in cancer development and progression［J］. J Natl Cancer Inst， 2000， 92（18）： 1472-1489.
18	EL-BADRY O M， HELMAN L J， CHATTEN J， et al. Insulin-like growth factor Ⅱ-mediated proliferation of human neuroblastoma［J］. J Clin Invest， 1991， 87（2）： 648-657.
19	HEFFELFINGER S C， MILLER M A， YASSIN R， et al. Angiogenic growth factors in preinvasive breast disease［J］. Clin Cancer Res， 1999， 5（10）： 2867-2876.
20	GUI Y R， AGUILAR-MAHECHA A， KRZEMIEN U， et al. Metastatic breast carcinoma-associated fibroblasts have enhanced protumorigenic properties related to increased IGF2 expression［J］. Clin Cancer Res， 2019， 25（23）： 7229-7242.
21	MARTINO M D， FORZATI F， MARFELLA M， et al. HMGA1P7-pseudogene regulates H19 and Igf2 expression by a competitive endogenous RNA mechanism［J］. Sci Rep， 2016， 6： 37622.
22	BERTEAUX N， APTEL N， CATHALA G， et al. A novel H19 antisense RNA overexpressed in breast cancer contributes to paternal IGF2 expression［J］. Mol Cell Biol， 2008， 28（22）： 6731-6745.

Primer	Primer sequence（3'-5'）
IGF2 Forward：	CTTGGACTTTGAGTCAAATTGGCCT
Reverse：	GAGGAGCCAGTCTGGGTTGTTGCTA
H19 Forward：	CTTTACAACCACTGCACTACCTG
Reverse：	GCCATGAAGATGGAGTCGCCG

Primer	Primer sequence（3'-5'）
IGF2 Forward：	CTTGGACTTTGAGTCAAATTGGCCT
Reverse：	GAGGAGCCAGTCTGGGTTGTTGCTA
H19 Forward：	GATCGGTGCCTCAGCGTTCG
Reverse：	GTCCTGCTTGTCACGTCCAC
β-actin Forward：	CAGGTCATCACCATTGGCAATGAGC
Reverse：	CGGATGTCCACGTCACACTTCATGA

Group	n	H19/IGF2 homozygous	H19/IGF2 heterozygous	H19 homozygous /IGF2 heterozygous	H19 heterozygous /IGF2 homozygous
Luminal	86	33 (38.4)	19 (22.1)	15 (17.4）	19 (22.1)
HER2+	14	6 (42.9)	6 (42.9)	1 (7.1)	1 (7.1)
Triple-negative	17	6 (35.3)	7 (41.2)	3 (17.6)	1 (5.9)

Group	n
Group	n	H19 genotype	Expressed	IGF2 genotype	Expressed
LOI of H19 and IGF2	1	A/C	a/c	T/C	t/c
LOI of IGF2	8	A/C	a	T/C	t/c
	6	A/C	c	T/C	t/c
	8	A	a	T/C	t/c

Group	n	H19/IGF2 MOI	H19/IGF2 LOI	H19 MOI/IGF2 LOI
Luminal	19	4 (21.1)	2 (10.5)	13 (68.4)
HER2+	6	1 (16.7)	0 (0.0)	5 (83.3)
TNBC	7	1 (14.3)	0 (0.0)	6 (85.7)

Expression levels and imprinting status of lncRNA H19 and IGF2 genes in breast cancer tissue

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 9

References 22

Related Articles 15

Metrics

Comments

Recommended 10

[1]	Xiaomin FU,Jianling JIA,Yanhong DOU,Wenyong REN,Aiping SHI. Research progress in effect of intestinal flora on occurrence and development of breast cancer and its therapeutic application [J]. Journal of Jilin University(Medicine Edition), 2024, 50(4): 1182-1188.
[2]	Yuesheng ZHAO,Zubin LI,Haiou LIU,Kunlin TAO,Qihai ZHAO,Na LI. Inhibitory effect of silencing CDKL1 gene on proliferation and invasion of breast cancer MCF-7 cells by regulating PTEN/Akt/mTOR signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2023, 49(5): 1234-1242.
[3]	Changchun MU,Chunji QUAN,Quanjin JIN,Zhengri PIAO. Expression of thymosin beta4 in breast cancer tissue and its effect on migration and invasion of breast cancer cells [J]. Journal of Jilin University(Medicine Edition), 2023, 49(4): 890-895.
[4]	Xiuyan YU,Ting LI,Zhanjie CONG,Wenlong WANG,Xiaowei ZHANG,Xuefeng WU. Combined detection of hMAM, SBEM and CEACAM19 mRNA in peripheral blood of breast cancer patients and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2022, 48(1): 195-202.
[5]	Xiuyan YU,Chunying TIAN,Xiaowei ZHANG,Xuefeng WU. Clinical significances of serum levels of SBEM, hMAM and CEACAM19 in early diagnosis of breast cancer [J]. Journal of Jilin University(Medicine Edition), 2021, 47(6): 1518-1525.
[6]	Yang YU,Sainan LIU,Yunkai LIU,Yong LI,Yichun QIAO,Yi CHENG. Bioinformatic analysis on expression characteristics of PRPS2 and its relationship with prognosis of breast cancer [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1229-1236.
[7]	Pei GONG, Jingran LIU, Shimin ZHAO, Yuzhen WANG, Jiming XIE. Inhibitory effect of MCM10 silencing on proliferation of breast cancer MDA-MB-231 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(3): 652-659.
[8]	Qing WANG,Siqi XIE,Kai ZHENG,Yiyin TANG,Hongwan LI,Hengyu ZHANG,Mingjian TAN,Lei PENG,Dequan LIU,Shicong TANG. Detection of serum vitamin-B levels in breast cancer patients receiving different chemotherapy regimens and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2021, 47(3): 724-730.
[9]	Haoxuan TANG,Nanfeng MENG,Meiling DU,Wei WANG,Tao HE. Inhibitory effect of new VEGF monoclonal antibody combined with all-trans retinoic acid on proliferation of breast cancer MCF-7 cells [J]. Journal of Jilin University(Medicine Edition), 2021, 47(2): 344-351.
[10]	KONG Wencong, HE Wubin, SU Rongjian, JIA Daqi, GU Yanjiao, WANG Yue, DU Xiaoyuan. Inhibitory effect and apoptosisinduction of MST1R inhibitor BMS-777607 on proliferation of breast cancer MCF-7 cells [J]. Journal of Jilin University(Medicine Edition), 2020, 46(03): 451-457.
[11]	ZHANG Lifang, CAI Lin, WANG Yunhua, ZHANG Keshi, WU Rina. Analysis on association between selenoprotein P polymorphism and risk of papillary thyriod carcinoma [J]. Journal of Jilin University(Medicine Edition), 2020, 46(02): 383-388.
[12]	CHEN Zhouhua, GONG Hui, FENG Lei, XIAO Yujie, HUANG Lizhong. Induction of LPS on epithelial mesenchymal transition in breast cancer MDA-MB-231 cells and its effect on β-catenin expression [J]. Journal of Jilin University(Medicine Edition), 2020, 46(02): 309-315.
[13]	ZHOU Chun, WANG Guanghua, ZHANG Bangzhu. Effects of miR-367 on proliferation, invasion and migration of human breast cancer MCF-7 cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2019, 45(06): 1353-1360.
[14]	YANG Zhuangqing, LU Mei, YANG Xiaojuan, WANG Chang'an, ZOU Jieya. Inhibitory effect of inhibiting TRIM24 gene expression on proliferation, apopotosis,invasion and migration of breast cancer MCF-7 cells [J]. Journal of Jilin University(Medicine Edition), 2019, 45(06): 1379-1383.
[15]	YUE Yuan, XU Yinglian, WANG Jingjing, SUN Minying, ZHANG Zenan, ZHAO Xinyue, LI Zongpu, TAI Guixiang. Inhibitory effects of down-regulation of JNK enzymatic activity on growth of human prostate cancer cells, hepatocellular carcinoma cells and breast cancer cells [J]. Journal of Jilin University(Medicine Edition), 2019, 45(05): 1046-1051.