Journal of Jilin University(Medicine Edition) ›› 2021, Vol. 47 ›› Issue (6): 1337-1346.doi: 10.13481/j.1671-587X.20210601
• Research in basic medicine • Next Articles
Mimi REN,Menghan GAO,Jing WANG,Jiamei LAI,Jinyu YU,Hang YUAN()
Received:
2021-06-29
Online:
2021-11-28
Published:
2021-12-14
Contact:
Hang YUAN
E-mail:hangyuan75@foxmail.com
CLC Number:
Mimi REN,Menghan GAO,Jing WANG,Jiamei LAI,Jinyu YU,Hang YUAN. Protective effect of 12/15-lipoxygenase gene knockout on kidney tissue of obesity-related glomerulopathy model mice and its mechanism[J].Journal of Jilin University(Medicine Edition), 2021, 47(6): 1337-1346.
Tab.1
Primer sequences"
Primer | Sequence |
---|---|
Adiponectin (M) | Forward:GTTGCAAGCTCTCCTGTTCC Reverse:TCTCCAGGAGTGCCATCTCT |
TNF-α (M) | Forward:TGTTGCCTCCTCTTTTGCTT Reverse:TGGTCACCAAATCAGCGTTA |
IL-6 (M) | Forward:ACAAAGCCAGAGTCCTTC Reverse:ACCACAGTGAGGAATGTCCAC |
MCP-1 (M) | Forward:TTAAAAACCTGGATCGGAACC Reverse:GCATTAGCTTCAGATTTACGG |
PAI-1 (M) | Forward:GACGCCTTCATTTGGACGAA Reverse:CGGACCTTTTCCCTTCAAGAGTCCG |
TGF-β1 (M) | Forward:AGGAAGGACCTGGGTTGGAAG Reverse:CGTCTCGACCCACGTAGTAGACG |
CTGF (M) | Forward:CAGCTCCGAGAAGGGTCAAGCTG Reverse:AACAGGCGCTCCACTCTGTG |
COL 1a1 (M) | Forward:CGGATAGCAGATTGAGAACATCCG Reverse:CGGCTGAGTAGGGAACACACA |
β-actin (R/M) | Forward:CCCTGTATGCCTCTGGTCGT Reverse:CGGACGCAGCTCAGTAACAGTCCG |
1 | COLLINS A J, FOLEY R N, HERZOG C, et al. Excerpts from the US renal data system 2009 annual data report[J]. Am J Kidney Dis, 2010, 55(1): A6-A7. |
2 | CAO H. Adipocytokines in obesity and metabolic disease[J]. J Endocrinol, 2014, 220(2): T47-T59. |
3 | CHAGNAC A, WEINSTEIN T, KORZETS A, et al. Glomerular hemodynamics in severe obesity[J]. Am J Physiol Ren Physiol, 2000, 278(5): F817-F822. |
4 | XU H Z, CHENG Y L, WANG W N,et al. 12-lipoxygenase inhibition on microalbuminuria in type-1 and type-2 diabetes is associated with changes of glomerular angiotensin II type 1 receptor related to insulin resistance[J]. Int J Mol Sci, 2016, 17(5): 684. |
5 | DOBRIAN A D, MORRIS M A, TAYLOR-FISHWICK D A, et al. Role of the 12-lipoxygenase pathway in diabetes pathogenesis and complications[J]. Pharmacol Ther, 2019, 195: 100-110. |
6 | YUAN H, REDDY M A, DESHPANDE S, et al. Epigenetic histone modifications involved in profibrotic gene regulation by 12/15-lipoxygenase and its oxidized lipid products in diabetic nephropathy[J]. Antioxid Redox Signal, 2016, 24(7): 361-375. |
7 | TERSEY S A, MAIER B, NISHIKI Y, et al. 12-lipoxygenase promotes obesity-induced oxidative stress in pancreatic islets[J]. Mol Cell Biol, 2014, 34(19): 3735-3745. |
8 | TRAJCEVSKI K E, O’NEILL H M, WANG D C,et al.Enhanced lipid oxidation and maintenance of muscle insulin sensitivity despite glucose intolerance in a diet-induced obesity mouse model[J]. PLoS One, 2013, 8(8): e71747. |
9 | YEUNG J, HOLINSTAT M. 12-lipoxygenase: a potential target for novel anti-platelet therapeutics[J]. Cardiovasc Hematol Agents Med Chem,2011,9(3): 154-164. |
10 | LOPATEGI A, LÓPEZ-VICARIO C, ALCARAZ-QUILES J, et al. Role of bioactive lipid mediators in obese adipose tissue inflammation and endocrine dysfunction[J]. Mol Cell Endocrinol, 2016, 419: 44-59. |
11 | CHAKRABARTI S K, WEN Y, DOBRIAN A D,et al. Evidence for activation of inflammatory lipoxygenase pathways in visceral adipose tissue of obese Zucker rats[J].Am J Physiol Endocrinol Metab,2011,300(1): E175-E187. |
12 | MA K, NUNEMAKER C S, WU R,et al. 12-lipoxygenase products reduce insulin secretion and β-cell viability in human islets[J]. J Clin Endocrinol Metab, 2010,95(2): 887-893. |
13 | HERNANDEZ-PEREZ M, CHOPRA G, FINE J,et al. Inhibition of 12/15-lipoxygenase protects against β-cell oxidative stress and glycemic deterioration in mouse models of type 1 diabetes[J]. Diabetes, 2017, 66(11): 2875-2887. |
14 | UYSAL K T, WIESBROCK S M, HOTAMISLIGIL G S.Functional analysis of tumor necrosis factor (TNF) receptors in TNF-α-mediated insulin resistance in genetic obesity[J]. Endocrinology, 1998, 139(12): 4832-4838. |
15 | KUME S, UZU T, ARAKI S, et al. Role of altered renal lipid metabolism in the development of renal injury induced by a high-fat diet[J]. J Am Soc Nephrol, 2007, 18(10): 2715-2723. |
16 | ROUBICEK T, BARTLOVA M, KRAJICKOVA J, et al. Increased production of proinflammatory cytokines in adipose tissue of patients with end-stage renal disease[J]. Nutrition, 2009, 25(7/8): 762-768. |
17 | LIAO M T, SUNG C C, HUNG K C, et al. Insulin resistance in patients with chronic kidney disease[J]. J Biomed Biotechnol, 2012, 2012: 691369. |
18 | PARVANOVA A I, TREVISAN R, ILIEV I P, et al. Insulin resistance and microalbuminuria: a cross-sectional, case-control study of 158 patients with type 2 diabetes and different degrees of urinary albumin excretion[J]. Diabetes, 2006, 55(5): 1456-1462. |
19 | CUSUMANO A M, BODKIN N L, HANSEN B C, et al. Glomerular hypertrophy is associated with hyperinsulinemia and precedes overt diabetes in aging rhesus monkeys[J]. Am J Kidney Dis, 2002, 40(5): 1075-1085. |
20 | ABRASS C K, RAUGI G J, GABOUREL L S, et al. Insulin and insulin-like growth factor I binding to cultured rat glomerular mesangial cells[J]. Endocrinology, 1988, 123(5): 2432-2439. |
21 | CHAKRABARTI S K, COLE B K, WEN Y, et al. 12/15-lipoxygenase products induce inflammation and impair insulin signaling in 3T3-L1 adipocytes[J]. Obesity (Silver Spring), 2009, 17(9): 1657-1663. |
[1] | Xin SHEN,Yang LIU,Hongyu CHEN,Jie ZHANG,Qingli CHENG,Guang YANG. Regulatory effect of high glucose on polarization of RAW264.7 macrophages via miR-125b in mice [J]. Journal of Jilin University(Medicine Edition), 2022, 48(4): 847-857. |
[2] | Shuang HUANG,Chen CHEN,Bo HUANG. Effects of limonin on lipid metabolism and intestinal flora in nutritionally obese rats [J]. Journal of Jilin University(Medicine Edition), 2022, 48(4): 858-865. |
[3] | Na HAN,Fanping LIU,Yanqing TIAN,Zhiqing ZHENG,Weiming LANG,Qian WANG,Yatao LIU,Jianguang ZHU. Regulatory effect of miRNA-27a on immune function in experimental pulmonary tuberculosis rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(1): 104-110. |
[4] | Song SU,Hongbo WANG,Yucong MA,Xin FANG,Junrong LIU,Hongmei QIAO. Kawasaki disease with inflammatory changes in parapharyngeal space:A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2022, 48(1): 228-233. |
[5] | Yong HE,Li HONG,Guotao HUANG,Zhihan ZHAO. Effect of palmitic acid on induction of lipid deposition in skeletal muscle cells [J]. Journal of Jilin University(Medicine Edition), 2021, 47(6): 1380-1385. |
[6] | Yan ZHAO,Pengcheng YU,Yu WANG,Yingping WANG,Pingya LI,Jinping LIU. Effect of apoptosis of 3T3-L1 adipocytes induced by panaxadiol and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1154-1161. |
[7] | Liyan ZHU,Yaoming WANG,Zheng QIN,Huanhuan ZHAO,Zengying WANG,Xiuhong YANG. Improvement effect of angiotensin(1-7) on kidney injury induced by limb ischemia-reperfusion in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(4): 834-841. |
[8] | Xue LUAN, Guanghai YAN, Haibo LI, Bo ZHANG, Wei ZHANG, Yuanyuan HUANG. Effect of salidroside on airway inflammation in mice with asthma and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(3): 537-544. |
[9] | Lijun YAN,Shengquan TONG,Jing LIU,Dongmei GAO,Nanfang CHEN,Jie HU. Therapeutic effect of total glucosides of paeony in model rats with rheumatoid arthritis by mediating TLR4/NF-κB signaling pathway and its mechanisim [J]. Journal of Jilin University(Medicine Edition), 2021, 47(2): 390-396. |
[10] | Yuhua PIAO,Zhiguang WANG,Yihua PIAO,Jingzhi JIANG,Chongyang WANG,Chang XU,Liangchang LI,Guanghai YAN,Hongmei PIAO. Effect of polydatin on airway inflammation in experimental asthmatic mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2020, 46(6): 1111-1116. |
[11] | QIAO Liangwei, QU Qingshan, LI Ming. Effect of LncRNA-ATB on acute rejection of kidney transplanted rats by regulating miR-200c expression [J]. Journal of Jilin University(Medicine Edition), 2020, 46(05): 955-962. |
[12] | ZHAO Liping, HUANG Shubing, ZHANG Boping, ZHOU Zhilan, JIA Xuebing, SUN Mengfei, QIAO Chenmeng, CHEN Xue, SHEN Yanqin, CUI Chun. Inhibitory effect of Lactobacillus rhamnosus on intestinal inflammation after spinal cord injury in zebrafishes and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2020, 46(04): 680-686. |
[13] | WANG Yazhou, HE Peng, WANG Danhong. Effects of montelukast on proliferation and apoptosis of airway smooth muscle cells in asthmatic rats by inhibiting TLR4/NF-κB signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2020, 46(02): 274-279. |
[14] | ZHAO Jun, LIANG Jinyu. Improvement effects of aerobic exercise combined with resistance training on body composition, cardiovascular function and serum C-reactive protein level in male obese college students [J]. Journal of Jilin University(Medicine Edition), 2019, 45(05): 1134-1140. |
[15] | WANG Tianyue, ZHOU Qianlan, SHANG Yunxiao. Effect of epigallocatechin-3-gallate on airway inflammation and Treg/Th17 immune balance of mice with obese asthma [J]. Journal of Jilin University(Medicine Edition), 2019, 45(03): 491-497. |