Journal of Jilin University(Medicine Edition) ›› 2023, Vol. 49 ›› Issue (4): 840-849.doi: 10.13481/j.1671-587X.20230403
• Research in basic medicine • Previous Articles Next Articles
Xuying WANG,Mingzhen JING(),Jin YU,Rong FU,Ru YANG
Received:
2022-07-27
Online:
2023-07-28
Published:
2023-07-26
Contact:
Mingzhen JING
E-mail:304101925@qq.com
CLC Number:
Xuying WANG,Mingzhen JING,Jin YU,Rong FU,Ru YANG. Effects of miR-181a-5p and BACH2 expressions on apoptosis and invasion of leukemic CCRF-CEM cells[J].Journal of Jilin University(Medicine Edition), 2023, 49(4): 840-849.
Tab.1
PCR primer sequences"
Primer | Sequence (5'-3') |
---|---|
MMP-9 | F:GTCCTCGCCCTGAACCTG |
R:GGCACAGTAGTGGCCGTAGA | |
MMP-14 | F:ATCATTGAGGTGGACGAGG |
R:GGGAACGCTGGCAGTAG | |
BACH2 | F:AGCAAGAACCGCATCGC |
R:TGGGAAAGGCAGGAGAAG | |
GAPDH | F:GGGAAACTGTGGCGTGAT |
R:GAGTGGGTGTCGCTGTTGA | |
miR-181a-5p | F:GGAACATTCAACGCTGTCG |
R:CTGGTGTCGTGGAGTCGG | |
U6 | F:CTCGCTTCGGCAGCACA |
R:AACGCTTCACGAATTTGCGT |
Tab.2
Proliferation activities of cells in various groups"
Group | Proliferation activity | ||
---|---|---|---|
(t/h) 24 | 48 | 72 | |
Control | 0.79±0.02 | 0.95±0.01 | 1.05±0.01 |
Inhibitor-NC | 0.79±0.02 | 0.97±0.01 | 1.05±0.01 |
MiR-181a-5p inhibitor | 0.69±0.01 | 0.76±0.02* | 0.79±0.14* |
OverExpBACH2 | 0.62±0.01 | 0.70±0.01* | 0.74±0.03* |
MiR-181a-5p inhibitor+EV | 0.69±0.00 | 0.77±0.02* | 0.81±0.04* |
MiR-181a-5p inhibitor+overExpBACH2 | 0.57±0.01 | 0.64±0.01*△# | 0.65±0.09*△# |
Tab.3
Percentages of cells at G2 phase and apoptotic rates of cells in various groups"
Group | Percentage of cells at G2 phase | Apoptotic rate |
---|---|---|
Control | 10.72±0.26 | 6.58±0.52 |
Inhibitor-NC | 10.42±0.26 | 7.14±0.36 |
MiR-181a-5p inhibitor | 16.76±0.47* | 24.93±0.61* |
OverExpBACH2 | 19.11±0.38* | 28.35±1.69* |
MiR-181a-5p inhibitor+EV | 16.45±0.24* | 24.39±0.67* |
MiR-181a-5p inhibitor+overExpBACH2 | 24.16±0.27*△# | 38.56±0.68*△# |
Tab.4
Expression levels of MMP-9, MMP-14, BACH2 mRNA, and miR-181a-5p in cells in various groups"
Group | MMP-9 mRNA | MMP-14 mRNA | BACH2 mRNA | miR-181a-5p |
---|---|---|---|---|
Control | 1.00±0.02 | 1.00±0.02 | 1.00±0.05 | 1.00±0.01 |
Inhibitor-NC | 1.07±0.10 | 1.03±0.10 | 0.90±0.10 | 0.98±0.03 |
MiR-181a-5p inhibitor | 0.45±0.06* | 0.50±0.06* | 1.82±0.15* | 0.52±0.02* |
OverExpBACH2 | 0.28±0.02* | 0.26±0.02* | 10.13±0.32* | 0.29±0.02* |
MiR-181a-5p inhibitor+EV | 0.43±0.02* | 0.41±0.02* | 2.01±0.27* | 0.49±0.06* |
MiR-181a-5p inhibitor+overExpBACH2 | 0.08±0.01*△# | 0.10±0.01*△# | 17.03±1.36*△# | 0.13±0.01*△# |
1 | GUTIERREZ-CAMINO A, GARCIA-OBREGON S, LOPEZ-LOPEZ E, et al. miRNA deregulation in childhood acute lymphoblastic leukemia: a systematic review[J]. Epigenomics, 2020, 12(1): 69-80. |
2 | NABIZADEH F, MOMTAZ S, GHANBARI-MOVAHED M, et al. Pediatric acute lymphoblastic leukemia management using multitargeting bioactive natural compounds: a systematic and critical review[J]. Pharmacol Res, 2022, 177: 106116. |
3 | LYU X M, LI J B, YUN X, et al. miR-181a-5p, an inducer of Wnt-signaling, facilitates cell proliferation in acute lymphoblastic leukemia[J]. Oncol Rep, 2017, 37(3): 1469-1476. |
4 | YANG C, PASSOS GIBSON V, HARDY P. The role of miR-181 family members in endothelial cell dysfunction and tumor angiogenesis[J].Cells, 2022, 11(10): 1670. |
5 | LIU X D, LIAO W, PENG H X, et al. miR-181a promotes G1/S transition and cell proliferation in pediatric acute myeloid leukemia by targeting ATM[J]. J Cancer Res Clin Oncol, 2016, 142(1): 77-87. |
6 | ZHENG Y X, LU Y W, HUANG X F, et al. BACH2 regulates the function of human CD4+CD45RA-Foxp3l ° cytokine-secreting T cells and promotes B-cell response in systemic lupus erythematosus[J]. Eur J Immunol, 2020, 50(3): 426-438. |
7 | 王旭颖, 荆明箴, 付 荣, 等. 过表达转录因子BACH2对人急性淋巴细胞白血病T淋巴细胞活力及凋亡的影响[J]. 中国病理生理杂志, 2020, 36(10): 1776-1781. |
8 | LIGUORI M, NUZZIELLO N, LICCIULLI F, et al. Combined microRNA and mRNA expression analysis in pediatric multiple sclerosis: an integrated approach to uncover novel pathogenic mechanisms of the disease[J]. Hum Mol Genet, 2018, 27(1): 66-79. |
9 | LV M, LIU Y, LIU W,et al.Immunotherapy for pediatric acute lymphoblastic leukemia: recent advances and future perspectives[J].Front Immunol,2022,13:921894. |
10 | BERGERON B P, DIEDRICH J D, ZHANG Y, et al. Epigenomic profiling of glucocorticoid responses identifies cis-regulatory disruptions impacting steroid resistance in childhood acute lymphoblastic leukemia[J]. Leukemia, 2022, 36(10): 2374-2383. |
11 | ZHANG L X, GAO J, LONG X, et al. The circular RNA circHMGB2 drives immunosuppression and anti-PD-1 resistance in lung adenocarcinomas and squamous cell carcinomas via the miR-181a-5p/CARM1 axis[J]. Mol Cancer, 2022, 21(1): 110. |
12 | VON BEEK C, ALRIKSSON L, PALLE J, et al. Dynamin inhibition causes context-dependent cell death of leukemia and lymphoma cells[J]. PLoS One, 2021, 16(9): e0256708. |
13 | TETIK VARDARLı A, DÜZGÜN Z, ERDEM C,et al. Matrine induced G0/G1 arrest and apoptosis in human acute T-cell lymphoblastic leukemia (T-ALL) cells[J]. Bosn J Basic Med Sci, 2018, 18(2): 141-149. |
14 | GAO Y, LI H, HAN Q, et al. Overexpression of DUSP6 enhances chemotherapy-resistance of ovarian epithelial cancer by regulating the ERK signaling pathway[J]. J Cancer, 2020, 11(11): 3151-3164. |
15 | EREKAT N S. Programmed cell death in diabetic nephropathy: a review of apoptosis, autophagy, and necroptosis[J]. Med Sci Monit, 2022, 28: e937766. |
16 | XI H Y, WANG S, WANG B B, et al. The role of interaction between autophagy and apoptosis in tumorigenesis (Review)[J].Oncol Rep,2022,48(6):208. |
17 | DEHKORDI M H, MUNN R G K, FEARNHEAD H O.Non-canonical roles of apoptotic caspases in the nervous system[J].Front Cell Dev Biol,2022,10: 840023. |
18 | WANG M S, CHEN L, XIONG Y Q, et al. Iron oxide magnetic nanoparticles combined with actein suppress non-small-cell lung cancer growth in a p53-dependent manner[J]. Int J Nanomedicine, 2017, 12: 7627-7651. |
19 | ULUTAŞ P A, KıRAL F, ULUTAŞ B, et al. Cytotoxic and apoptotic effect of nanoclinoptilolite on canine osteosarcoma cell lines[J]. J Vet Res, 2020, 64(4): 589-596. |
20 | LI M, YAN T T, CAI Y Q, et al. Expression of matrix metalloproteinases and their association with clinical characteristics of solid tumors[J].Gene,2023,850: 146927. |
21 | AUGOFF K, HRYNIEWICZ-JANKOWSKA A, TABOLA R, et al. MMP9: a tough target for targeted therapy for cancer[J]. Cancers, 2022, 14(7): 1847. |
22 | ESCALONA R M, KANNOURAKIS G, FINDLAY J K,et al. Expression of TIMPs and MMPs in ovarian tumors, ascites, ascites-derived cells, and cancer cell lines: characteristic modulatory response before and after chemotherapy treatment[J].Front Oncol,2021,11:796588. |
23 | REGGIANI F, LABANCA V, MANCUSO P, et al. Adipose progenitor cell secretion of GM-CSF and MMP9 promotes a stromal and immunological microenvironment that supports breast cancer progression[J]. Cancer Res, 2017, 77(18): 5169-5182. |
24 | CANDIDO S, TOMASELLO B, LAVORO A, et al. Bioinformatic analysis of the LCN2-SLC22A17-MMP9 network in cancer: the role of DNA methylation in the modulation of tumor microenvironment[J]. Front Cell Dev Biol, 2022, 10: 945586. |
25 | LIU H, HU G H, WANG Z Y, et al. circPTCH1 promotes invasion and metastasis in renal cell carcinoma via regulating miR-485-5p/MMP14 axis[J]. Theranostics, 2020, 10(23): 10791-10807. |
[1] | Yuanying SONG,Jing KAN,Kun PENG,Yue LI. Effect of honeysuckle extract on proliferation and apoptosis of airway smooth muscle cells in asthmatic model mice [J]. Journal of Jilin University(Medicine Edition), 2023, 49(4): 1001-1007. |
[2] | Meng LIU,Xiaodong HUANG,Zheng HAN,Qingxi ZHU,Jie TAN,Xia TIAN. Effect of cadherin-17 on proliferation and apoptosis of colorectal cancer cells and its PI3K/AKT/mTOR signaling pathway regulatory mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(4): 1008-1017. |
[3] | Li JIN,Xiaohong ZHANG,Chaoyang HU,Fengzhi LI,Yongliang CUI,Yang LI,Qianqian LIU,Yanjun QIAO. Effects of quercetin on growth and lung metastasis of transplanted tumor and cell invasion, and cell migration in human lung cancer A549 cells transplanted tumor model mice and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2023, 49(4): 1018-1026. |
[4] | Hongyuan TIAN,Caiyun YIN,Li WANG,Peiyun HU,Chenyang ZHANG,Qiuyue LI,Qingzhao ZHENG,Yali QI,Fang FANG,Zhicheng WANG. Effects of hydroxyurea combined with radiation on cell cycle and apoptosis of cells after silencing ATRX [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 590-598. |
[5] | Xingye WANG,Xiangri KONG,Mengli JIN,Bingmei WANG,Mingquan LI. Improvement effect of β-sitosterol on cognitive function in Alzheimer’s disease model mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 599-607. |
[6] | Shengyu YAN,Changhua LIU,Zhijie XU,Yating DING,Yafeng XIE,Qiao ZHANG,Wanying LIU. Effect of lncRNA PAX8-AS1 on proliferation, apoptosis and invasion of colorectal cancer cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 656-664. |
[7] | Zhou YANG,Shudian LIN,Yuwei ZHAN,Lu XIAO,Keying FU,Xiaodie HUANG. Effects of down-regulation of ROCK2 expression targeted by miR-94-5p on proliferation, migration and invasion of rheumatoid arthritis fibroblast-like synoviocytes [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 665-674. |
[8] | Shuya ZHANG,Hongying SUN,Jian MAO,Chengxi MENG,Gelong BA. Expression of circ_EFCAB2 in epileptic cell model and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 691-696. |
[9] | Hui MIAO,Congxiu MIAO,Na LI,Jing HAN. Inhibitory effect of lncRNA HAND2-AS1 on migration and invasion of endometrial stromal cells in patients with endometriosis by regulating expression of miR-21 [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 733-741. |
[10] | Rui LI,Xiaodong TAN,Yaoyuan HU. Inhibitory effect of pachylic acid on migration, invasion, and epithelial-mesenchymal transition of human pancreatic cancer PANC-1 cells [J]. Journal of Jilin University(Medicine Edition), 2023, 49(2): 315-323. |
[11] | Kai WANG,Han HUANG. Effects of atorvastatin on proliferation, apoptosis, and migration of human tongue squamous cell carcinoma CAL-27 cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2023, 49(2): 324-331. |
[12] | Yifei SUN,Dinuo LI,Yubin WANG. Inhibitory effect of curcumin on proliferation and invasion of gastric cancer MGC-803 cells by down-regulating PI3K/Akt/mTOR signaling pathway protein expression [J]. Journal of Jilin University(Medicine Edition), 2023, 49(2): 332-340. |
[13] | Junyi JIN,Mu LI,Yaoyuan HU,Yihui WANG. Targeting relationship between miR-150-5p and NCAPG and its inhibitory effect on hepatocellular carcinoma Huh7 cells [J]. Journal of Jilin University(Medicine Edition), 2023, 49(1): 122-130. |
[14] | Yanya CHEN,Jinlan ZHAO,Chan LI,Lishan HUANG. Expression of miR-223 in ovarian cancer tissue and its promoting effect on proliferation and invasion of ovarian cancer OVCAR3 cells [J]. Journal of Jilin University(Medicine Edition), 2023, 49(1): 150-157. |
[15] | Junxiong ZHAO,Qian WU,Liangui NIE,Shengquan LIU,Zhentao JIANG,Jian CHEN,Ting XIAO,Jun YANG. Ameliorative effect of SO2 on myocardial fibrosis in type 2 diabetes mellitus rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(1): 8-14. |
|