盐酸小檗碱调控PI3K/AKT/mTOR信号通路对感染1型单纯疱疹病毒HeLa细胞自噬的影响

doi:10.13481/j.1671-587X.20250616

Abstract

Abstract:

Objective To discuss the effect of berberine hydrochloride （BBR） on autophagy in the HeLa cells infected with herpes simplex virus type 1 （HSV-1）， and to clarify its related mechanism. Methods The HeLa cells at logarithmic growth phase were added with 0， 10， 20， 40， 80， 120， and 160 μmol·L^-1 BBR， respectively， and cultured for 24 h. In addition， the HeLa cells were divided into HSV-1 group （the cells were infected with HSV-1）， L-BBR group （were infected with HSV-1 and then treated with 20 μmol·L^-1 BBR for 24 h）， M-BBR group （were infected with HSV-1 and then treated with 40 μmol·L^-1 BBR for 24 h）， H-BBR group （were infected with HSV-1 and then treated with 80 μmol·L^-1 BBR for 24 h）， and 740 Y-P group （were infected with HSV-1 and then treated with 80 μmol·L^-1 BBR and 10 μmol·L^-1 740 Y-P for 24 h） for viral infection and corresponding drug treatment. MTT method was used to detect the activities of microtubule-associated protein 1 light chain 3 （LC3） the HeLa cells after treated with different concentrations of BBR； plaque reduction assay was used to detect the proliferation ability of HSV-1 in the HeLa cells in various groups； real-time fluorescence quantitative PCR （RT-qPCR） method was used to detect the mRNA expression levels of virus replication-related genes in the HeLa cells in various groups； immunofluorescence method was used to detect the formation of autophagosomes in the HeLa cells in various groups； flow cytometry was used to detect the apoptotic rate of the HeLa cells in various groups； Western blotting method was used to detect the expression levels of autophagy and the phosphoinositide 3-kinase （PI3K）/protein kinase B（AKT）/mammalian target of rapamycin （mTOR） pathway pathway-related proteins in the HeLa cells in various groups. Results The MTT method results showed that compared with 0 μmol·L^-1 BBR group， the activities of the HeLa cells in 120 and 160 μmol·L^-1 BBR groups were significantly decreased （P<0.05）， which had certain toxicity to the cells； 20， 40， and 80 μmol·L^-1 BBR were selected for subsequent experiments. The plaque reduction assay results showed that compared with HSV-1 group， the plaque forming units（PFUs） in the HeLa cells in L-BBR group， M-BBR group， and H-BBR group were significantly decreased （P<0.05） in a dose-dependent manner； compared with H-BBR group， the PFUs in the HeLa cells in 740 Y-P group were significantly increased （P<0.05）. The RT-qPCR results showed that compared with HSV-1 group， the mRNA expression levels of infected cell protein 0 （ICP0）， infected cell protein 22 （ICP22）， infected cell protein 8 （ICP8）， thymidine kinase （TK）， glycoprotein B （gB）， and glycoprotein D （gD） in the HeLa cells in L-BBR group， M-BBR group， and H-BBR group were significantly decreased （P<0.05） in a dose-dependent manner； compared with H-BBR group， the expression levels of ICP0， ICP22， ICP8， TK， gB， and gD mRNA in the HeLa cells in 740 Y-P group were significantly increased （P<0.05）. The immunofluorescence method results showed that compared with HSV-1 group， the number of LC3 autophagosomes formed in the HeLa cells in L-BBR group， M-BBR group， and H-BBR group was increased； compared with H-BBR group， the number of LC3 autophagosomes formed in the HeLa cells in 740 Y-P group was decreased. The flow cytometry results showed that compared with HSV-1 group， the apoptotic rates of the HeLa cells in L-BBR group， M-BBR group， and H-BBR group were significantly increased （P<0.05） in a dose-dependent manner； compared with H-BBR group， the apoptotic rate of the HeLa cells in 740 Y-P group was significantly decreased （P<0.05）. The Western blotting method results showed that compared with HSV-1 group， the expression levels of Beclin-1 and B-cell lymphoma 2 （Bcl-2）/adenovirus E1B 19kDa protein interacting protein protein（BNIP） 2 proteins and the ratios of LC3-Ⅱ/LC3-Ⅰ in the HeLa cells in L-BBR group， M-BBR group， and H-BBR group were significantly increased （P<0.05） in a dose-dependent manner； compared with H-BBR group， the expression levels of Beclin-1 and BNIP proteins and the LC3-Ⅱ/LC3-Ⅰ ratio in the HeLa cells in 740 Y-P group were significantly decreased （P<0.05）； compared with HSV-1 group， the expression levels of cysteine-containing aspartate protein hydrolase 1 （Caspase-1）， cysteine-containing aspartate protein hydrolase 3 （Caspase-3）， and Bcl-2 associated X protein （Bax） proteins in the HeLa cells in L-BBR group， M-BBR group， and H-BBR group were significantly increased （P<0.05）， and the expression level of Bcl-2 protein was significantly decreased （P<0.05） in a dose-dependent manner； compared with H-BBR group， the expression levels of Caspase-1， Caspase-3， and Bax proteins in the HeLa cells in 740 Y-P group were significantly decreased （P<0.05）， and the expression level of Bcl-2 protein was significantly increased （P<0.05）； compared with HSV-1 group， the ratios of phosphorylated PI3K （p-PI3K）/PI3K， phosphorylated AKT（p-AKT）/AKT， and phosphorylated mTOR （p-mTOR）/mTOR in the HeLa cells in L-BBR group， M-BBR group， and H-BBR group were significantly decreased （P<0.05） in a dose-dependent manner； compared with H-BBR group， the ratios of p-PI3K/PI3K， p-Akt/Akt， and p-mTOR/mTOR in the HeLa cells in 740 Y-P group were significantly increased （P<0.05）. Conclusion BBR can promote the autophagy process in the HeLa cells infected with HSV-1 by regulating the PI3K/AKT/mTOR pathway， induce autophagy-dependent apoptosis， and significantly inhibit the virus replication.

Key words: Berberine hydrochloride, Phosphatidylinositol 3-kinase, Protein kinase B, Mammalian target of rapamycin pathway, Herpes simplex virus type 1, Autophagy

CLC Number:

R373.9

Haidong ZHU,Changkun LYU,Wei SHI. Effect of berberine hydrochloride on autophagy of HeLa cells infected with herpes simplex virus type 1 by regulating PI3K/AKT/mTOR signaling pathway[J].Journal of Jilin University(Medicine Edition), 2025, 51(6): 1607-1617.

Figures/Tables 13

Tab.1

Fig. 1

Fig. 2

Tab.2

Fig. 3

Fig. 4

Tab.3

Fig. 5

Tab.4

Fig. 6

Tab.5

Fig.7

Tab.6

References 28

[1]	CHANG J Y， BALCH C， PUCCIO J， et al. A narrative review of alternative symptomatic treatments for herpes simplex virus［J］. Viruses， 2023， 15（6）： 1314.
[2]	ALMUKDAD S， HARFOUCHE M， FAROOQUI U S， et al. Epidemiology of herpes simplex virus type 1 and genital herpes in Australia and New Zealand： systematic review， meta-analyses and meta-regressions［J］. Epidemiol Infect， 2023， 151： e33.
[3]	GOPINATH D， KOE K H， MAHARAJAN M K， et al. A comprehensive overview of epidemiology， pathogenesis and the management of herpes labialis［J］. Viruses， 2023， 15（1）： 225.
[4]	BHUTTA M S， SHECHTER O， GALLO E S， et al. Ginkgolic acid inhibits herpes simplex virus type 1 skin infection and prevents zosteriform spread in mice［J］. Viruses， 2021， 13（1）： 86.
[5]	YAN C， LUO Z， LI W， et al. Disturbed Yin-Yang balance： stress increases the susceptibility to primary and recurrent infections of herpes simplex virus type 1［J］. Acta Pharm Sin B， 2020， 10（3）： 383-398.
[6]	ZHU C P， LI K Q， PENG X X， et al. Berberine a traditional Chinese drug repurposing： Its actions in inflammation-associated ulcerative colitis and cancer therapy［J］. Front Immunol， 2022， 13： 1083788.
[7]	ŠUDOMOVÁ M， BERCHOVÁ-BÍMOVÁ K， MARZOCCO S， et al. Berberine in human oncogenic herpesvirus infections and their linked cancers［J］. Viruses， 2021， 13（6）： 1014.
[8]	LIU Z J， WEI J H， SUN H B， et al. Plumbagin ameliorates LPS-induced acute lung injury by regulating PI3K/AKT/mTOR and Keap1-Nrf2/HO-1 signalling pathways［J］. J Cell Mol Med， 2024， 28（13）： e18386.
[9]	TANG Q， LUAN F， YUAN A， et al. Sophoridine suppresses herpes simplex virus type 1 infection by blocking the activation of cellular PI3K/Akt and p38 MAPK pathways［J］. Front Microbiol， 2022， 13： 872505.
[10]	LI F， SONG X W， SU G F， et al. AT-533， a Hsp90 inhibitor， attenuates HSV-1-induced inflammation［J］. Biochem Pharmacol， 2019， 166： 82-92.
[11]	ASHA K， SHARMA-WALIA N. Targeting host cellular factors as a strategy of therapeutic intervention for herpesvirus infections［J］. Front Cell Infect Microbiol， 2021， 11： 603309.
[12]	HASSAN S T S. Brassicasterol with dual anti-infective properties against HSV-1 and mycobacterium tuberculosis， and cardiovascular protective effect： nonclinical in vitro and in silico assessments［J］. Biomedicines， 2020， 8（5）： 132.
[13]	SADOWSKI L A， UPADHYAY R， GREELEY Z W， et al. Current drugs to treat infections with herpes simplex viruses-1 and-2［J］. Viruses， 2021， 13（7）： 1228.
[14]	SONG S W， QIU M， CHU Y， et al. Downregulation of cellular c-Jun N-terminal protein kinase and NF-κB activation by berberine may result in inhibition of herpes simplex virus replication［J］. Antimicrob Agents Chemother， 2014， 58（9）： 5068-5078.
[15]	CHIN L W， CHENG Y W， LIN S S， et al. Anti-herpes simplex virus effects of berberine from Coptidis rhizoma， a major component of a Chinese herbal medicine， Ching-Wei-San［J］. Arch Virol， 2010， 155（12）： 1933-1941.
[16]	DREMEL S E， DELUCA N A. Genome replication affects transcription factor binding mediating the cascade of herpes simplex virus transcription［J］. Proc Natl Acad Sci USA， 2019， 116（9）： 3734-3739.
[17]	KIM J H， WEERATUNGA P， KIM M S， et al. Inhibitory effects of an aqueous extract from Cortex Phellodendri on the growth and replication of broad-spectrum of viruses in vitro and in vivo ［J］. BMC Complement Altern Med， 2016， 16： 265.
[18]	PINO-BELMAR C， AGUILAR R， VALENZUELA-NIETO G E， et al. An intrinsic host defense against HSV-1 relies on the activation of xenophagy with the active clearance of autophagic receptors［J］. Cells， 2024， 13（15）： 1256.
[19]	RIPA I， ANDREU S， LÓPEZ-GUERRERO J A， et al. Interplay between autophagy and herpes simplex virus type 1： ICP34.5， one of the main actors［J］. Int J Mol Sci， 2022， 23（21）： 13643.
[20]	AHMAD L， MOSTOWY S， SANCHO-SHIMIZU V. Autophagy-virus interplay： from cell biology to human disease［J］. Front Cell Dev Biol， 2018， 6： 155.
[21]	LIU Y， TANG Q， RAO Z L， et al. Inhibition of herpes simplex virus 1 by cepharanthine via promoting cellular autophagy through up-regulation of STING/TBK1/P62 pathway［J］. Antiviral Res， 2021， 193： 105143.
[22]	SU L J， ZHANG J H， GOMEZ H， et al. Mitochondria ROS and mitophagy in acute kidney injury［J］. Autophagy， 2023， 19（2）： 401-414.
[23]	LIU Y， CHEN L， LIU W J， et al. Cepharanthine suppresses herpes simplex virus type 1 replication through the downregulation of the PI3K/Akt and p38 MAPK signaling pathways［J］. Front Microbiol， 2021， 12： 795756.
[24]	ZHAN Y， YU S Q， YANG S， et al. Newcastle Disease virus infection activates PI3K/Akt/mTOR and p38 MAPK/Mnk1 pathways to benefit viral mRNA translation via interaction of the viral NP protein and host eIF4E［J］. PLoS Pathog， 2020， 16（6）： e1008610.
[25]	KE L， YANG Y N， LI J W， et al. Modulation of corneal FAK/PI3K/Akt signaling expression and of metalloproteinase-2 and metalloproteinase-9 during the development of herpes simplex keratitis［J］. Biomed Res Int， 2019， 2019： 4143981.
[26]	LI W M， XU C J， HAO C， et al. Inhibition of herpes simplex virus by myricetin through targeting viral gD protein and cellular EGFR/PI3K/Akt pathway［J］. Antiviral Res， 2020， 177： 104714.
[27]	MOKHFI F Z， AMIN MAL， ZEHRAVI M， et al. Alkaloid-based modulators of the PI3K/Akt/mTOR pathway for cancer therapy： Understandings from pharmacological point of view［J］. Chem Biol Interact， 2024， 402： 111218.
[28]	SHI X Z， ZHAO S， WANG Y， et al. Antitumor activity of berberine by activating autophagy and apoptosis in CAL-62 and BHT-101 anaplastic thyroid carcinoma cell lines［J］. Drug Des Devel Ther， 2023， 17： 1889-1906.

Primer	Forward （5'-3'）	Reverse （5'-3'）
ICP0	TGTGCACGGATGAGATCG	TCGTTCACGATCGGGATG
ICP22	ATGGACAAGGTAACCATCGG	TTGAAAAACGGAAGGGGGTA
ICP8	TGAAGTTCCTCCCCCTCCAC	TGAAGTTCCTCCCCCTCCACGGAGACCATCATCACCAACC
TK	CGATGACTTACTGGCGGGTGT	GCGTCGGTCACGGCATAA
gB	GCCTTCTTCGCCTTTCGC	CGCTCGTGCCCTTCTTCTT
gD	CCCGATCACGGTTTACTACG	AGCGATGGTCAGGTTGTAGG
GAPDH	CAGCCTCAAGATCATCAGCAA	CCATCACGCCACAGTTTCC

Group	ICP0	ICP22	ICP8	TK	gB	gD
HSV-1	1.01±0.02	0.98±0.10	1.06±0.13	1.01±0.09	1.05±0.12	0.99±0.09
L-BBR	0.85±0.09^*	0.79±0.06^*	0.80±0.09^*	0.83±0.08^*	0.79±0.07^*	0.71±0.08^*
M-BBR	0.61±0.08^*△	0.50±0.07^*△	0.58±0.07^*△	0.66±0.05^*△	0.59±0.08^*△	0.52±0.06^*△
H-BBR	0.33±0.05^*#	0.23±0.04^*#	0.22±0.05^*#	0.30±0.06^*#	0.20±0.05^*#	0.23±0.04^*#
740 Y-P	0.65±0.07^○	0.56±0.07^○	0.64±0.08^○	0.49±0.05^○	0.58±0.06^○	0.59±0.08^○
F	462.461	330.150	247.229	401.737	289.045	309.713
P	<0.01	<0.01	<0.01	<0.01	<0.01	<0.01

Group	Apoptotic rate
HSV-1	5.36±0.25
L-BBR	11.03±1.16^*
M-BBR	17.94±2.29^*△
H-BBR	30.23±4.91^*△#
740 Y-P	16.62±3.15^○
F	31.734
P	<0.01

Group	Beclin-1	BNIP	LC3-Ⅱ/LC3-Ⅰ
HSV-1	0.29±0.04	0.35±0.05	0.15±0.04
L-BBR	0.62±0.07^*	0.67±0.08^*	0.47±0.06^*
M-BBR	0.98±0.09^*△	0.93±0.10^*△	0.91±0.10^*△
H-BBR	1.33±0.14^*△#	1.41±0.15^*△#	1.32±0.13^*△#
740 Y-P	0.59±0.07^○	0.53±0.07^○	0.92±0.09^○
F	64.124	60.267	78.190
P	<0.01	<0.01	<0.01

Group	Caspase-1	Caspase-3	Bcl-2	Bax
HSV-1	0.23±0.04	0.35±0.05	1.41±0.12	0.29±0.04
L-BBR	0.45±0.06^*	0.61±0.07^*	1.12±0.08^*	0.47±0.05^*
M-BBR	0.71±0.07^*△	0.94±0.09^*△	0.89±0.09^*△	0.88±0.09^*△
H-BBR	1.06±0.11^*△#	1.35±0.12^*△#	0.33±0.04^*△#	1.13±0.12^*△#
740 Y-P	0.66±0.07^○	0.53±0.08^○	0.64±0.07^○	0.82±0.07^○
F	56.375	66.705	92.733	53.700
P	<0.01	<0.01	<0.01	<0.01

Effect of berberine hydrochloride on autophagy of HeLa cells infected with herpes simplex virus type 1 by regulating PI3K/AKT/mTOR signaling pathway

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 13

References 28

Related Articles 15

Metrics

Comments

Recommended 0

Group	p-PI3K/PI3K	p-AKT/AKT	p-mTOR/mTOR
HSV-1	1.54±0.16	1.39±0.13	1.62±0.15
L-BBR	1.10±0.12^*	1.12±0.09^*	1.20±0.09^*
M-BBR	0.87±0.07^*△	0.93±0.07^*△	0.95±0.10^*△
H-BBR	0.49±0.06^*△#	0.33±0.05^*△#	0.46±0.06^*△#
740 Y-P	0.71±0.08^○	0.62±0.07^○	0.68±0.08^○
F	65.806	87.165	92.312
P	<0.01	<0.01	<0.01

[1]	Bing BAI,Qian ZHANG,Tao PU,Yu NI,Tingting HU,Linhong HU,Yibin YANG. Effect of angiopoietin 1 and tyrosine kinase receptor 2 inhibitor on glucose transportation in endothelial cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1487-1497.
[2]	Wei AN, MAIMAITITUXUN·Tuerdi,Zhitao YAO. Regulatory effect of lutein on PI3K/AKT signaling pathway and chondrocyte autophagy in mandibular joint cartilage tissue of rabbits and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 976-983.
[3]	Cheng CHEN,Jingyao LI,Wanxiang HU,Donghui LIU,Zhihong CHEN. Protective effect of sericin on streptozotocin-induced INS-1 cell damage by regulating PI3K/Akt/NF-κB signaling pathway through Akt1 and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 590-598.
[4]	Yihui WANG,Qing ZHANG,Yingnan LI,Liping YE. Effect of KIAA1522 on proliferation, migration, and invasion of lung cancer cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(3): 727-739.
[5]	Ying YANG,Liang ZHAO,Yong YOU,Qian XU,Zhenjun YANG. Influence of 17β-estradiol in proliferation and differentiation of hippocampal neural stem cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 317-324.
[6]	Mengyun LU,Yucheng HAN,Yihong HU,Minhui HE,Yanqun ZHANG,Xianqiong ZOU. Effects of glycolipid transfer protein on proliferation, migration，and invasion of pancreatic cancer PANC-1 cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2025, 51(2): 284-295.
[7]	Min CHEN,Huiyan ZHU,Jing TAO,Yipeng XU. Ameliorating effect of betaine on oxygen-glucose deprivation injury in rat brain microvascular endothelial cells and its influence in PI3K/AKT pathway [J]. Journal of Jilin University(Medicine Edition), 2025, 51(1): 96-104.
[8]	Chaohe ZHANG,Xinwei ZHANG,Xiangfeng WANG. Protective effect of Pien-Tze-Huang on acetaminophen-induced liver injury and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(1): 105-114.
[9]	Guobin HE,Huan WANG. Effect of knockdown of RIP3 on autophagy, pyroptosis， and ferroptosis of hypoxia/reoxygenation-induced human renal tubular epithelial HK2 cells [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1644-1653.
[10]	Gao SUN,Jing HE,Qi ZHAO,Jianhong SHI,Zhiling LIAO,Yuanye TIAN,Guomin WU. Therapeutic effect of resveratrol on osteoarthritis of temporomandibular joint and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1547-1556.
[11]	Jing LOU,Lei ZHAO,Yanjie ZHU,Shuaiqiang YUAN,Fei WANG,Hangzhou ZHANG,Jiaojiao XU,Xiaoke YU,Liufa HOU. Effect of Fuzheng Ruanjian Anticancer Formula on malignant biological behaviors of hepatocellulars carcinoma HepG2 cells by regulating Akt/MDM2/P53 signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1654-1663.
[12]	Yuxiao SHI,Meilan LIU,Meilin ZHU,Feng WEI. Effects of 5-Aza-CdR on autophagy and apoptosis of papillary thyroid cancer cells in subcutaneous xenograft tumor tissue of nude mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(5): 1330-1338.
[13]	Yutong WANG,Ruili RAN,Jiang BIAN,Xiaohan JIANG,Junqiu SONG,Dewei WANG,Jing YANG. Protective effect of carnosine against oxygen-glucose deprivation/reoxygenation-induced astrocyte injury through inhibition of autophagy by AMPK/mTOR signaling pathway [J]. Journal of Jilin University(Medicine Edition), 2024, 50(5): 1297-1304.
[14]	Guoxing YU,Xin ZHANG,Hengwei DU,Bingjie CUI,Na GAO,Cuilan LIU,Jing DU. Effect of urolithin C on proliferation, apoptosis and autophagy of human acute myeloid leukemia HL-60 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(4): 908-916.
[15]	Xueting CHI,Fangyuan CHEN,Zifeng PI,Guangfu LYU,Yuchen WANG,Yinqing LI,Xiaowei HUANG,Zhe LIN. Improvement effect of velvet antler polypeptide on postmenopausal osteoporosis in rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2024, 50(4): 963-969.