柯萨奇病毒A16型3C蛋白对人横纹肌肉瘤细胞凋亡的诱导作用及其机制

doi:10.13481/j.1671-587X.20210408

Abstract

Abstract: Objective

To investigate the effect of Coxsackievirus A16 3C protein on the apoptosis of rhabdomyosarcoma RD cells， and to illuminate its possible mechanism.

Methods

The RD cells were cultured in vitro and divided into control group （transfected with 0.4 μg pCMV-HA）， 0.1 μg pCMV-HA-3C group （transfected with 0.1 μg pCMV-HA-3C and 0.3 μg pCMV-HA）， 0.2 μg pCMV-HA-3C group （transfected with 0.2 μg pCMV-HA-3C and 0.2 μg pCMV-HA），0.4 μg pCMV-HA-3C group （transfected with 0.4 μg pCMV-HA-3C） and protein kinase B（AKT） activator SC79 treatment group （pretreated with 4 mg·L^－1　SC79 for 4 h， then transfected with 0.2 μg pCMV-HA-3C and 0.2 μg pCMV-HA）.The survival rates of cells in various groups were detected by MTT assay，the apoptotic rates were detected by flow cytometry， the expression levels of Bcl-2 homologous antagonist /killer （Bak），Bcl-2 associated agonist of cell death （Bad） and p53 up-regulated modulator of apoptosis （PUMA） mRNA were detected by Real-time fluorescence quantitative PCR （RT-qPCR），and the expression levels of Bad， Bak， PUMA， PARP， cleaved-PARP， cleaved-caspase-3 and phosphorylated AKT （p-AKT） proteins in the RD cells in various groups were detected by Western blotting method.

Results

Compared with control group， the survival rate of the cells 0.4 μg pCMV-HA-3C group was significantly decreased （P<0.01）. Compared with control group， the apoptotic rate of the cells in pCMV-HA-3C group was significantly increased （P<0.01）. Compared with control group，the mRNA and protein expression levels of Bak， Bad and PUMA in 0.2 μg PCMV-HA-3C group were significantly increased （P<0.05）， and the expression levels of cleaved-PARP and cleaved-caspase-3 proteins in different doses of pCMV-HA-3C groups were significantly increased （P<0.05）.Compared with control group， the expression levels of cleaved-PARP and cleaved-caspase-3 proteins in 0.2 μg pCMV-HA-3C group were significantly increased （P<0.05），and the expression level of p-AKT protein was significantly decreased （P<0.01）. Compared with 0.2 μg pCMV-HA-3C group，the the expression levels of cleaved-PARP，cleaved-caspase-3 and AKT proteins in the cells in SC79 treatment group were significantly decreased（P<0.05），and the p-AKT protein expression level was significantly increased （P<0.01）.

Conclusion

Coxsackievirus A16 3C protein may induce the apoptosis of RD cells by inhibiting AKT signaling pathway.

Key words: Coxsackievirus A16, 3C protein, protein kinase B signaling pathway, apoptosis

CLC Number:

R373.23

Yingying SHI,Shitong CHEN,Bo HU,Duo SHEN,Kuang ZHU,Siwei YE,Jinmei FENG. Induction of 3C protein of Coxsackievirus A16 in apoptosis of human rhabdomyosarcoma cells and its mechanism[J].Journal of Jilin University(Medicine Edition), 2021, 47(4): 874-881.

Figures/Tables 10

Tab. 1

Fig. 1

Tab. 2

Fig. 2

Fig. 3

Tab. 3

Fig.4

Tab.4

Fig. 5

Tab. 5

References 22

1	MAO Q Y， WANG Y P， YAO X， et al. Coxsackievirus A16： epidemiology， diagnosis， and vaccine［J］. Hum Vaccines Immunother， 2014， 10（2）： 360-367.
2	ZHANG M， ZHAO Y L， ZHANG H H， et al. Molecular characterization of Coxsackievirus A16 strains isolated from children with severe hand， foot， and mouth disease in Yunnan， Southwest China， during 2009-2015［J］. J Med Virol， 2019， 91（1）： 155-160.
3	ASTRUP B S， JOHNSEN I B， ENGSBRO A L. The role of Coxsackievirus A16 in a case of sudden unexplained death in an infant-A SUDI case［J］. Forensic Sci Int， 2016，259： e9-e13.
4	KVANSAKUL M. Viral infection and apoptosis［J］. Viruses， 2017， 9（12）： 356.
5	SHIM J M， KIM J， TENSON T， et al. Influenza virus infection， interferon response， viral counter-response， and apoptosis［J］. Viruses， 2017， 9（8）： E223.
6	ZHU G， ZHENG Y， ZHANG L， et al. Coxsackievirus A16 infection triggers apoptosis in RD cells by inducing ER stress［J］. Biochem Biophys Res Commun， 2013，441（4）：856-861.
7	SHI Y Y， HE X H， ZHU G G， et al. Coxsackievirus A16 elicits incomplete autophagy involving the mTOR and ERK pathways［J］. PLoS One， 2015， 10（4）： e0122109.
8	LU G W， QI J X， CHEN Z J， et al. Enterovirus 71 and coxsackievirus A16 3C proteases： binding to rupintrivir and their substrates and anti-hand， foot， and mouth disease virus drug design［J］. J Virol， 2011， 85（19）： 10319-10331.
9	RAMAJAYAM R， TAN K P， LIANG P H. Recent development of 3C and 3CL protease inhibitors for anti-coronavirus and anti-picornavirus drug discovery［J］. Biochem Soc Trans， 2011，39（5）：1371-1375.
10	RUI Y J， SU J M， WANG H， et al. Disruption of MDA5-mediated innate immune responses by the 3C proteins of coxsackievirus A16， coxsackievirus A6， and enterovirus D68［J］. J Virol， 2017， 91（13）： e00546.
11	LI J， YAO Y F， CHEN Y， et al. Enterovirus 71 3C promotes apoptosis through cleavage of PinX1， a telomere binding protein［J］. J Virol， 2017， 91（2）： e02016.
12	REN Y J， SHU T， WU D， et al. The ORF3a protein of SARS-CoV-2 induces apoptosis in cells［J］. Cell Mol Immunol， 2020， 17（8）： 881-883.
13	XU Y S， VICTORIO C B L， MENG T， et al. The saffold virus-Penang 2B and 3C proteins， but not the L protein， induce apoptosis in HEp-2 and vero cells［J］. Virol Sin， 2019， 34（3）： 262-269.
14	ADAMS J M， CORY S. The Bcl-2 protein family： arbiters of cell survival［J］. Science， 1998，281（5381）：1322-1326.
15	KAZI A， SUN J， DOI K， et al. The BH3 alpha-helical mimic BH3-M6 disrupts Bcl-X（L）， Bcl-2， and MCL-1 protein-protein interactions with Bax， Bak， Bad， or Bim and induces apoptosis in a Bax- and Bim-dependent manner［J］. J Biol Chem， 2011，286（11）：9382-9392.
16	DANG Y N， ZHANG Y F， XU L Y， et al. PUMA-mediated epithelial cell apoptosis promotes Helicobacter pylori infection-mediated gastritis［J］. Cell Death Dis， 2020， 11（2）： 139.
17	BOULARES A H， YAKOVLEV A G， IVANOVA V，et al. Role of poly（ADP-ribose） polymerase （PARP） cleavage in apoptosis. Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells［J］. J Biol Chem， 1999，274（33）：22932-22940.
18	CHOUDHARY G S， AL-HARBI S， ALMASAN A. Caspase-3 activation is a critical determinant of genotoxic stress-induced apoptosis［J］. Methods Mol Biol， 2015，1219： 1-9.
19	FRANKE T F， HORNIK C P， SEGEV L， et al. PI3K/Akt and apoptosis： size matters［J］. Oncogene， 2003，22（56）：8983-8998.
20	BROTELLE T， BAY J O. PI3K-AKT-mTOR pathway： Description， therapeutic development， resistance， predictive/prognostic biomarkers and therapeutic applications for cancer［J］. Bull Cancer， 2016，103（1）：18-29.
21	PONNUSAMY L， KOTHANDAN G， MANOHARAN R. Berberine and Emodin abrogates breast cancer growth and facilitates apoptosis through inactivation of SIK3-induced mTOR and Akt signaling pathway［J］. Biochim Biophys Acta Mol Basis Dis， 2020，1866（11）：165897.
22	ZHAI H， KANG Z H， ZHANG H B， et al. Baicalin attenuated substantia nigra neuronal apoptosis in Parkinson’s disease rats via the mTOR/AKT/GSK-3β pathway［J］. J Integr Neurosci， 2019， 18（4）： 423-429.

Gene	Primer sequence（5'－3'）
Bak	Forward AGGGCTTAGGACTTGGTTTG
Bak	Reverse GGGATTCCTAGTGGTGTTGATAG
Bad	Forward GGAGGATGAGTGACGAGTTTG
Bad	Reverse GGAGCTTTGCCGCATCT
PUMA	Forward GTGACCACTGGCATTCATTTG
PUMA	Reverse TCCTCCCTCTTCCGAGATTT
β-actin	Forward CACGATGGAGGGGCCGGACTCATC
β-actin	Reverse TAAAGACCTCTATGCCAACACAGT

Group	Survival rate
Control	90.00±5.98
pCMV-HA-3C 0.1 μg	85.83±5.71
0.2 μg	82.68±6.02
0.4 μg	65.09±3.78^*

Group	Bak		Bad		PUMA
Group	mRNA	Protein	mRNA	Protein	mRNA	Protein
Control	1.02±0.14	0.69±0.01	1.02±0.12	0.77±0.01	1.01±0.10	0.80±0.01
0.2 μg pCMV-HA-3C	1.54±0.11^*	0.78±0.01^**	1.72±0.05^**	0.83±0.01^*	1.73±0.19^*	0.85±0.01^*

Group	PARP	Cleaved- PARP	Cleaved- caspase-3
Control pCMV-HA-3C	0.88±0.01	0.71±0.01	0.55±0.01
0.1 μg	0.86±0.01	0.75±0.01^*	0.60±0.01^*
0.2 μg	0.82±0.07	0.77±0.01^*	0.68±0.01^*
0.4 μg	0.70±0.02^**	0.99±0.03^**	0.88±0.03^**

Group	Cleaved-PARP	Cleaved-caspase-3	AKT	p-AKT
Control	0.82±0.01	0.81±0.01	1.02±0.02	0.98±0.01
0.2 μg pCMV-HA-3C	1.07±0.01^*	1.16±0.02^*	1.10±0.01^*	0.82±0.01^**
SC79 treatment	0.84±0.01^ΔΔ	0.97±0.04^Δ	0.94±0.01^ΔΔ	1.10±0.01^ΔΔ

Induction of 3C protein of Coxsackievirus A16 in apoptosis of human rhabdomyosarcoma cells and its mechanism

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 10

References 22

Related Articles 15

Metrics

Comments

Recommended 10

[1]	Qingxu LANG,Xueshuang NIU,Kaiwen YANG,Ren ZHANG,Siteng WANG, ZUMIRETIGULI·Wumaier,Zhenqi WANG. Effects of sodium butyrate combined with ionizing radiation on apoptosis of lung cancer A549 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(4): 915-921.
[2]	Guanhu LI,Qingxu LANG,Chunyan LIU,Qin LIU,Mengrou GENG,Xiaoqian LI,Zhenqi WANG. Inhibitory effect of valproic acid combined with X-ray irradiation on proliferation of breast cancer MDA-MB-231 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(3): 622-629.
[3]	Qiuting CAO,Jingchun HAN,Xiaofei ZHANG. Effect of silencing helicase BLM gene on chemotherapy sensitivity of irinotecan in colorectal cancer cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(3): 657-667.
[4]	Cuilan LIU,Fengai HU,Jing LIU,Dan WANG,Changyun QIU,Dunjiang LIU,Di ZHAO. Effect of adiponectin receptor agonist AdiopRon on biological behaviors of glioma cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(3): 702-710.
[5]	Ming xing YANG,Wen DONG,Ji LI. Inductive effect of peiminine on apoptosis of lung cancer A549 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(3): 711-717.
[6]	Ming LI,Qiuting WANG,Shan CHEN,Huifang SHI. Improvement effect of p38 MAPK inhibitor on chronic obstructive pulmonary disease injury in mice through inhibiting cell pyrotosis mediated by NLRP3 pathway [J]. Journal of Jilin University(Medicine Edition), 2022, 48(3): 744-754.
[7]	Suxian CHEN,Zehui GU,Yangfei MA,Qi TAN,Qi LI,Yadi WANG. Promotion effect of rutin on apoptosis of human colon cancer SW480 cells and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(2): 356-363.
[8]	Zhihui ZHAO,Xianghua BAI,Jinling HE,Weiqin DUAN,Min LIU,Shengmao ZHANG. Inhibitory effect of sufentanil on apoptosis of myocardial cells in myocardial ischemia-reperfusion injury rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(2): 364-373.
[9]	Guangsong XU,Haibing JIANG,Jing PAN,Guoqing LI. Inhibitory effects of betulinic acid on migration and invasion of gastric cancer MGC-803 cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2022, 48(1): 122-128.
[10]	Wenxiong SUN,Pu LI. Expression of SOCS3 in peripheral blood mononuclear cells of patients with diffuse large B-cell lymphoma and its effect on autophagy and apoptosis of OCI-LY7 cells [J]. Journal of Jilin University(Medicine Edition), 2022, 48(1): 172-179.
[11]	Leihua CUI,Yubo HOU,Chang SU,Minghe LI,Xin NIE. Effect of N-acetylcysteine on apoptosis of MC3T3-E1 cells induced by nicotine and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(1): 26-32.
[12]	Yu ZHU,Jingjing WANG,Fang WU. Expression of miR-150-5p in kidney tissue of diabetic nephropathy model mice and its effect on MPC5 mouse podocyte injury and mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(1): 44-51.
[13]	Zhaohui WAN,Liang ZENG,Hui ZHOU. Effect of overexpression of Bax inhibitor 1 on cardiomyocyte apoptosis in rats with acute myocardial infarction and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(1): 74-81.
[14]	Daiqiang HUANG,Pengfei LIU,Jianbin HE,Jingxue SUN,Lin YUAN,Jing YUAN,Lei ZHAO. Effect of sevoflurane exposure during pregnancy period on maternal behavior of offspring of mice and protection mechanism of H₂ [J]. Journal of Jilin University(Medicine Edition), 2021, 47(6): 1347-1352.
[15]	Jingjing MA,Yu LIU,Yan LIANG,Ying LI. Promotion effect of total alkaloids of leonurus on decidual villus excretion in drug abortion rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(6): 1476-1484.