长链非编码RNA LINC00973对上皮性卵巢癌迁移、侵袭和远端转移的促进作用及其分子机制

doi:10.13481/j.1671-587X.20250402

Abstract

Abstract:

Objective To discuss the effect of long non-coding RNA（lncRNA） LINC00973 on the migration， invasion， and distant metastasis of epithelial ovarian cancer， and to clarify its molecular mechanism. Methods The human ovarian cancer SKOV3 and OVCAR3 cells were divided into EF1a-FH empty vector control group （control group）， LINC00973 overexpression group （LINC00973 OE group）， U6-shRNA empty vector control group （SHV group）， and LINC00973 knockdown group （LINC00973 KD group）， and were transfected with lentivirus containing nonsense sequence （pLent-EF1a-FH-CMV-copGFP-P2A-Puro）， LINC00973 overexpression， nonsense sequence （pLent-U6-shRNA-CMV-copGFP-P2A-Puro） and LINC00973 shRNA， respectively， followed by puromycin screening to obtain stably transfected SKOV3 and OVCAR3 cells. Real-time fluorescence quantitative PCR（RT-qPCR） method was used to detect the mRNA expression levels of target genes in the cells in various groups； wound healing assay was used to detect the migration rate of the cells in various groups； Transwell chamber assay was used to detect the number of transmembrane cells in various groups； The mice were divided into control group （WT group）， LINC00973 OE group， and LINC00973 KD group， with 4 mice in each group. SKOV3 wild-type cells， LINC00973 OE cells， and LINC00973 KD cells were intraperitoneally injected into the mice in various groups， respectively， to establish the epithelial ovarian cancer intraperitoneal implantation and metastasis model； HE staining was used to observe the morphology of the colon and liver tissues of the mice in various groups； RNA-secquencing （RNA-seq） was used to analyze the differentially expressed genes between SHV and LINC00973 KD groups in the SKOV3 cell line； RT-qPCR method was used to detect the mRNA expression levels of LINC00973 in the normal ovarian epithelial cells IOSE-80 and epithelial ovarian cancer cells SKOV3， A2780 and OVCAR3， the mRNA expression levels of LINC00973， Vimentin， Snail family transcriptional repressor 1 （Snail）， Twist family basic helix-loop-helix transcription factor 1 （Twist）， zinc finger E-box binding homeobox 1 （ZEB1）， zinc finger E-box binding homeobox 2 （ZEB2）， CXCL8 and matrix metalloproteinase （MMP） 16 in the cells in various groups， and the mRNA expression levels of LINC00973， Vimentin and Twist in liver and colon tissues of the mice in various groups. Results Compared with normal ovarian epithelial cells IOSE-80， the expression level of LINC00973 mRNA in the epithelial ovarian cancer cells SKOV3， OVCAR3 and A2780 was significantly increased （P<0.01）， with the highest expression level of LINC00973 in SKOV3 and OVCAR3 cells， which were therefore selected for subsequent experiments. In SKOV3 and OVCAR3 cells， compared with control group， the expression level of LINC00973 mRNA in the cells in LINC00973 OE group was increased （P<0.01）； compared with SHV group， the expression level of LINC00973 mRNA in the cells in LINC00973 KD group was decreased （P<0.05 or P<0.01）， indicating successful construction of LINC00973 overexpression and knockdown cell lines. In SKOV3 cells， compared with control group， the mRNA expression levels of Vimentin and Twist in LINC00973 OE group were increased （P<0.05 or P<0.01）， while no significant difference was observed in Snail mRNA expression level（P>0.05）； compared with SHV group， the mRNA expression levels of Vimentin， Snail and Twist in LINC00973 KD group were decreased （P<0.01）. In OVCAR3 cells， compared with control group， the mRNA expression levels of Vimentin， Snail and Twist in LINC00973 OE group were increased （P<0.01）； compared with SHV group， the expression levels of Vimentin， Snail， and mRNA Twist in LINC00973 KD group were decreased （P<0.01）. The wound healing assay results showed that compared with control group， the wound healing rates of the SKOV3 and OVCAR3 cells in LINC00973 OE group were significantly increased （P<0.01）； compared with SHV group， the wound healing rates of the cells in LINC00973 KD group were significantly decreased （P<0.01）. The Transwell chamber assay results showed that compared with control group， the numbers of transmembrane cells of the SKOV3 and OVCAR3 cells in LINC00973 OE group were significantly increased （P<0.01）； compared with SHV group， the numbers of transmembrane cells in LINC00973 KD group were significantly decreased （P<0.01）. Compared with WT group， the number of peritoneal nodules in LINC00973 OE group was increased， with rough liver surface and multiple nodules formed on mesentery and colon surface， and the expression levels of LINC00973， Vimentin， and Twist mRNA in colon tissue were increased （P<0.01）； compared with WT group， no nodules were formed in the peritoneal cavity of LINC00973 KD group， with smooth liver surface， no nodules in liver tissue， and decreased expression levels of LINC00973， Vimentin， and Twist mRNA， and no nodules were observed on mesentery and colon surface. The HE staining results showed that compared with WT group， the multiple lesions were observed in liver and colon tissues in LINC00973 OE group， manifested as uneven cell size， irregular shape， unclear cell boundaries， increased nuclear division， and uneven red staining in cytoplasm， while in LINC00973 KD group， the cells in liver and colon tissues were arranged neatly with regular shape， and uniform distribution of nuclei and cytoplasm. The RNA-seq results showed that compared with SHV group， no key signaling pathways related to tumor metastasis were enriched in LINC00973 KD group， and the transcription levels of metastasis-related genes CXCL8， MMP16， ZEB1， and ZEB2 were decreased. The RT-qPCR results showed that compared with control group， the expression levels of ZEB1， ZEB2， CXCL8， and MMP16 mRNA in the cells in LINC00973 OE group were significantly increased （P<0.01）； compared with SHV group， the expression levels of ZEB1， ZEB2， CXCL8， and MMP16 mRNA in the cells in LINC00973 KD group were significantly decreased （P<0.01）. Conclusion LINC00973 can up-regulate the expression of metastasis-related factors Vimentin， Snail， Twist， ZEB1， ZEB2， CXCL8， and MMP16， and promote the migration， invasion， and distant metastasis of epithelial ovarian cancer.

Key words: Ovarian neoplasm, Neoplasm metastasis, LINC00973, Real-time fluorescence quantitative PCR, Matrix metalloproteinases

CLC Number:

R737.31

Yunxiu XIA,Shuo ZHANG,Huanhai ZHANG,Fei WANG,Hongliang DONG,Jing DU. Long non-coding RNA LINC00973 promotes migration, invasion and distal metastasis of epithelial ovarian cancer and its molecular mechanism[J].Journal of Jilin University(Medicine Edition), 2025, 51(4): 866-878.

Figures/Tables 14

Tab. 1

Tab. 2

Tab.3

Tab.4

Fig. 1

Fig. 2

Fig. 3

Fig.4

Fig. 5

Fig. 6

Fig. 7

Fig. 8

Fig. 9

Fig. 10

References 35

[1]	WEBB P M， JORDAN S J. Global epidemiology of epithelial ovarian cancer［J］. Nat Rev Clin Oncol， 2024， 21（5）： 389-400.
[2]	TORRE L A， TRABERT B， DESANTIS C E， et al. Ovarian cancer statistics， 2018［J］. CA A Cancer J Clin， 2018， 68（4）： 284-296.
[3]	BRIDGES M C， DAULAGALA A C， KOURTIDIS A. LNCcation： lncRNA localization and function［J］. J Cell Biol， 2021， 220（2）： e202009045.
[4]	ZHANG Q， WU E Z， TANG Y H， et al. Deeply mining a universe of peptides encoded by long noncoding RNAs［J］. Mol Cell Proteomics， 2021， 20： 100109.
[5]	HERMAN A B， TSITSIPATIS D， GOROSPE M. Integrated lncRNA function upon genomic and epigenomic regulation［J］. Mol Cell， 2022， 82（12）： 2252-2266.
[6]	HE S L， CHEN Y L， CHEN Q H， et al. LncRNA KCNQ1OT1 promotes the metastasis of ovarian cancer by increasing the methylation of EIF2B5 promoter［J］. Mol Med， 2022， 28（1）： 112.
[7]	YU X， ZHAO P F， LUO Q Y， et al. RUNX1-IT1 acts as a scaffold of STAT1 and NuRD complex to promote ROS-mediated NF-κB activation and ovarian cancer progression［J］. Oncogene， 2024， 43（6）： 420-433.
[8]	LIN H， XU X， CHEN K L， et al. LncRNA CASC15， miR-23b cluster and SMAD3 form a novel positive feedback loop to promote epithelial-mesenchymal transition and metastasis in ovarian cancer［J］. Int J Biol Sci， 2022， 18（5）： 1989-2002.
[9]	KARPOV D S， SPIRIN P V， ZHELTUKHIN A O， et al. LINC00973 induces proliferation arrest of drug-treated cancer cells by preventing p21 degradation［J］. Int J Mol Sci， 2020， 21（21）： 8322.
[10]	ZINOVIEVA O L， GRINEVA E N， PROKOFJEVA M M， et al. Expression of long non-coding RNA LINC00973 is consistently increased upon treatment of colon cancer cells with different chemotherapeutic drugs［J］. Biochimie， 2018， 151： 67-72.
[11]	LIU Y B， LI X Z， ZHANG C M， et al. LINC00973 is involved in cancer immune suppression through positive regulation of Siglec-15 in clear-cell renal cell carcinoma［J］. Cancer Sci， 2020， 111（10）： 3693-3704.
[12]	GUO Q， LI D， LUO X Y， et al. The regulatory network and potential role of LINC00973-miRNA-mRNA ceRNA in the progression of non-small-cell lung cancer［J］. Front Immunol， 2021， 12： 684807.
[13]	TADIĆ V， ZHANG W， BROZOVIC A. The high-grade serous ovarian cancer metastasis and chemoresistance in 3D models［J］. Biochim Biophys Acta Rev Cancer， 2024， 1879（1）： 189052.
[14]	CAI Y S， LYU T， LI H， et al. LncRNA CEBPA-DT promotes liver cancer metastasis through DDR2/β-catenin activation via interacting with hnRNPC［J］. J Exp Clin Cancer Res， 2022， 41（1）： 335.
[15]	XIU B Q， CHI Y Y， LIU L， et al. LINC02273 drives breast cancer metastasis by epigenetically increasing AGR2 transcription［J］. Mol Cancer， 2019， 18（1）： 187.
[16]	WANG Y， LIU F， CHEN L， et al. Neutrophil extracellular traps （NETs） promote non-small cell lung cancer metastasis by suppressing lncRNA MIR503HG to activate the NF-κB/NLRP3 inflammasome pathway［J］. Front Immunol， 2022， 13： 867516.
[17]	HU H F， HAN L， FU J Y， et al. LINC00982-encoded protein PRDM16-DT regulates CHEK2 splicing to suppress colorectal cancer metastasis and chemoresistance［J］. Theranostics， 2024， 14（8）： 3317-3338.
[18]	TONG L L， WANG Y Y， AO Y， et al. CREB1 induced lncRNA HAS2-AS1 promotes epithelial ovarian cancer proliferation and invasion via the miR-466/RUNX2 axis［J］. Biomed Pharmacother， 2019， 115： 108891.
[19]	LIU J， ZHU Y， WANG H， et al. LINC00629， a HOXB4-downregulated long noncoding RNA， inhibits glycolysis and ovarian cancer progression by destabilizing c-Myc［J］. Cancer Sci， 2024， 115（3）： 804-819.
[20]	LI Y， LOU S H， ZHANG J， et al. m⁶A methylation-mediated regulation of LncRNA MEG3 suppresses ovarian cancer progression through miR-885-5p and the VASH1 pathway［J］. J Transl Med， 2024， 22（1）： 113.
[21]	FARDI M， ALIVAND M， BARADARAN B， et al. The crucial role of ZEB2： from development to epithelial-to-mesenchymal transition and cancer complexity［J］. J Cell Physiol， 2019， 234（9）： 14783-14799.
[22]	SáNCHEZ-TILLó E， PEDROSA L， VILA I， et al. The EMT factor ZEB1 paradoxically inhibits EMT in BRAF-mutant carcinomas［J］. JCI Insight， 2023， 8（20）：e164629.
[23]	POULIQUEN D L， BOISSARD A， HENRY C， et al. Curcuminoids as modulators of EMT in invasive cancers： a review of molecular targets with the contribution of malignant mesothelioma studies［J］. Front Pharmacol， 2022， 13： 934534.
[24]	SUN Z Q， SHAO B， LIU Z Q， et al. LINC01296/miR-141-3p/ZEB1-ZEB2 axis promotes tumor metastasis via enhancing epithelial-mesenchymal transition process［J］. J Cancer， 2021， 12（9）： 2723-2734.
[25]	LI Y Y， FEI H， LIN Q W， et al. ZEB2 facilitates peritoneal metastasis by regulating the invasiveness and tumorigenesis of cancer stem-like cells in high-grade serous ovarian cancers［J］. Oncogene， 2021， 40（32）： 5131-5141.
[26]	TATTI O， GUCCIARDO E， PEKKONEN P， et al. MMP16 mediates a proteolytic switch to promote cell-cell adhesion， collagen alignment， and lymphatic invasion in melanoma［J］. Cancer Res， 2015， 75（10）： 2083-2094.
[27]	YAN P F， WANG J， LIU H Y， et al. M1 macrophage-derived exosomes containing miR-150 inhibit glioma progression by targeting MMP16［J］. Cell Signal， 2023， 108： 110731.
[28]	YANG F Q， ZHANG J Q， JIN J J， et al. HOXA11-AS promotes the growth and invasion of renal cancer by sponging miR-146b-5p to upregulate MMP16 expression［J］. J Cell Physiol， 2018， 233（12）： 9611-9619.
[29]	LI Y Y， WANG Y， YU L， et al. miR-146b-5p inhibits glioma migration and invasion by targeting MMP16［J］. Cancer Lett， 2013， 339（2）： 260-269.
[30]	LIU Q， LI A P， TIAN Y J， et al. The CXCL8-CXCR1/2 pathways in cancer［J］. Cytokine Growth Factor Rev， 2016， 31： 61-71.
[31]	PIAO H Y， FU L F， WANG Y X， et al. A positive feedback loop between gastric cancer cells and tumor-associated macrophage induces malignancy progression［J］. J Exp Clin Cancer Res， 2022， 41（1）： 174.
[32]	FU X R， WANG Q M， DU H， et al. CXCL8 and the peritoneal metastasis of ovarian and gastric cancer［J］. Front Immunol， 2023， 14： 1159061.
[33]	ZHANG N， LIU Y Y， WANG Y Y， et al. Decitabine reverses TGF-β1-induced epithelial-mesenchymal transition in non-small-cell lung cancer by regulating miR-200/ZEB axis［J］. Drug Des Devel Ther， 2017， 11： 969-983.
[34]	CHOI P W， NG S W. The functions of microRNA-200 family in ovarian cancer： beyond epithelial-mesenchymal transition［J］. Int J Mol Sci， 2017， 18（6）： 1207.
[35]	ZHAO M N， ZHANG L F， SUN Z， et al. A novel microRNA-182/Interleukin-8 regulatory axis controls osteolytic bone metastasis of lung cancer［J］. Cell Death Dis， 2023， 14（5）： 298.

Gene	Primer（5'-3'）
LINC00973	F: CAAGGACAATTATTCCCTCAC R: GACAAAGCCAAGGATTCAGT
Vimentin	F: CGCCAACTACATCGACAAGGTGC R: CTGGTCCACCTGCCGGCGCAG
Snail	F: TCCACGAGGTGTGACTAACT R: CCGACAAGTGACAGCCATTA
Twist	F: CTAGAGACTCTGGAGCTGGATA R: TCTGGGAATCACTGTCCACG
ZEB1	F: AAGTGGCGGTAGATGGTA R: TGTTGTATGGGTGAAGCA
ZEB2	F: TCTGCGACATAAATACGA R: GAGTGAAGCCTTGAGTGC
MMP16	F: TGTGATGGACCAACAGAC R: ATACAAGAGGCATAAGG
CXCL8	F: CTAGTTTGATACTCCCAGTC R: AAGTTTCAACCAGCAAGA
GAPDH	F: CTCCTCCTGTTCGACAGTCAGC R: CCCAATACGACCAAATCCGTT

Group	Expression level of LINC00973
IOSE-80	1.000±0.019
SKOV3	211.916±15.037^*
OVCAR3	82.331±0.051^*
A2780	69.105±1.297^*
F	22.460
P	<0.01

Group	LINC00973
Control	1.001±0.049
LINC00973 OE	448.815±24.601^*
SHV	1.001±0.047
LINC00973 KD	0.351±0.024^△

Group	LINC00973
Control	1.003±0.074
LINC00973 OE	206.375±25.735^*
SHV	1.001±0.039
LINC00973 KD	0.696±0.060^△

Long non-coding RNA LINC00973 promotes migration, invasion and distal metastasis of epithelial ovarian cancer and its molecular mechanism

RichHTML

PDF (PC)

Like

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 14

References 35

Related Articles 15

Metrics

Comments

Recommended 0

[1]	Shuo ZHANG,Yunxiu XIA,Weiwei CHEN,Hongliang DONG,Bingjie CUI,Cuilan LIU,Zhiqiang LIU,Fei WANG,Jing DU. Effect of over-expression of NR2F2 on biological behaviors of human ovarian cancer SKOV3 cells [J]. Journal of Jilin University(Medicine Edition), 2025, 51(1): 58-67.
[2]	Jia ZHOU,Zhidong QIU,Zhe LIN,Guangfu LYU,Jiaming XU,He LIN,Kexin WANG,Yuchen WANG,Xiaowei HUANG. Effect of chelerythrine on migration, invasion, and epithelial-mesenchymal transition of human ovarian cancer SKOV3 cells [J]. Journal of Jilin University(Medicine Edition), 2024, 50(1): 25-32.
[3]	Shaoting HUANG,You LI,Zhaochun WU,Jiawen HE,Keqi LIAO,Shengnan LI. Construction of SOX17 over-expression lentiviral vector and stably transfected cell line [J]. Journal of Jilin University(Medicine Edition), 2023, 49(6): 1424-1430.
[4]	Jingjing LI, REZIWANGULI·Aisikaier,Wanyi XING,Yinggang ZOU. Primary dedifferentiated liposarcoma of unilateral ovary: A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2023, 49(4): 1040-1045.
[5]	Mengmeng CHEN,Junyu CHEN,Yan GAO,Zhengxuan FANG,Shuhua ZHAO,Jingying ZHENG,Shuxiang LIU. Expression level of gasdermin E in epithelial ovarian cancer tissue and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2023, 49(2): 440-451.
[6]	Mengshi MA,Peng CHEN,Zhongsen MA. Pulmonary benign metastasizing leiomyoma：A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2023, 49(1): 203-208.
[7]	Yanan MA,Bing TAN,Lei XU,Jiandong ZHANG. Detection of drug resistance genes of Acinetobacter baumannii in sputum samples of ICU patients by real-time fluorescence quantitative PCR method and its evaluation [J]. Journal of Jilin University(Medicine Edition), 2022, 48(6): 1623-1628.
[8]	Qinghui WANG,Bo LI,Chuancui HU,Mingchao NIE,Xiaomei ZHENG. Effects of miR-107 on regulation of immune escape and taxol resistance of ovarian cancer cells [J]. Journal of Jilin University(Medicine Edition), 2022, 48(3): 734-743.
[9]	Shuqing FENG,Yanhong YAO,Yue SHI,Zhibin LIU,Feng GAO. Application of real-time fluorescence quantitative PCR for detection of BCR/ABL gene expression in peripheral blood in hematopoietic stem cell transplantation therapy in patients with Ph⁺ acute lymphoblastic leukemia [J]. Journal of Jilin University(Medicine Edition), 2022, 48(1): 180-187.
[10]	Jingjing GE,Hongxia XU,Lixia XIE,Kaili DU,Ming SANG,Xiaodong SUN. Establishment of human serous ovarian cancer cell culture system in vitro and its application in chemotherapeutic drug sensitivity detection [J]. Journal of Jilin University(Medicine Edition), 2021, 47(4): 999-1007.
[11]	GUO Xiaofei, LIU Lihong, AI Hao. Expression of valosin-containing protein in epithelial ovarian cancer tissue and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2020, 46(03): 600-606.
[12]	PEI Yanling, LYU Hanghang, WANG Bowei, ZHANG Weiyang. Misdiagnosis of ovarian fibrothecoma as ovarian malignant tumor: A case report and literature review [J]. Journal of Jilin University(Medicine Edition), 2019, 45(04): 940-943.
[13]	WANG Yipin, HE Dongyun, HUANG Qiongwei, SHENG Minjia. Application value of risk ovarian malignancy algorithm in early diagnosis of epithelial ovarian cancer [J]. Journal of Jilin University(Medicine Edition), 2019, 45(04): 905-910.
[14]	XING Shugang, ZHANG Lihong, JIN Minghua, LI Baihui, WU Zexin, FANG Bo, LI Wei. Effects of myricetin on proliferation and apoptosis of glioma GL261 cells in mice [J]. Journal of Jilin University(Medicine Edition), 2018, 44(05): 955-961.
[15]	LIANG Bing, LIU Yang, SONG Jinping, QU Danhua, LIU Chunyan. Enhancement of histone deacetylase inhibitors SAHA in chemotherapeutic sensitivity of ovarian cancer SKOV3 cells [J]. Journal of Jilin University Medicine Edition, 2018, 44(03): 471-476.