Journal of Jilin University(Medicine Edition) ›› 2021, Vol. 47 ›› Issue (2): 453-459.doi: 10.13481/j.1671-587X.20210226
• Research in clinical medicine • Previous Articles Next Articles
Received:2020-07-17
Online:2021-03-28
Published:2021-03-25
Contact:
Yongchen LYU
E-mail:15543430749@126.com
CLC Number:
Weili HUANG,Yongchen LYU. Expressions of miR-1915-3p and Bcl-2 in human colon cancer and their clinical significances[J].Journal of Jilin University(Medicine Edition), 2021, 47(2): 453-459.
Tab.1
Primer sequences used in experiment"
| Primer | Sequence (5'-3') |
|---|---|
| miR-1915-3p-RT | GCACTTCAGTGTCGTGGTCAGTGACGGC- AATTGAAGTGCCCCGCCGC |
| miR-1915-3p | F:CAGACGACCATCAGCCCCAGGGCGA |
| R:CGCGGATCCATGTCTATTATTACAG | |
| U6 | F:GCTTCGGCAGCACATATACTAAAAT |
| R:CGCTTCACGAATTTGCGTGTCAT | |
| Bcl-2 | F:AGTGGGATGCGGGAGATGT |
| R:CGGGCTGGGAGGAGAAGA | |
| GAPDH | F:CATTCAAGACCGGACAGAGG |
| R:ACATACTCAGCACCAGCATCACC |
Tab.2
The relationships between the expression levels of miR-1915-3p and Bcl-2 and clinicopathological features in patients with colon cancer"
| Clinicopathological feature | n | miR-1915-3p | χ2 | P | Bcl-2 | χ2 | P | ||
|---|---|---|---|---|---|---|---|---|---|
| Low | High | Low | High | ||||||
| Gender | 0.001 | 0.972 | 0.029 | 0.864 | |||||
| Male | 26 | 17 | 9 | 9 | 17 | ||||
| Female | 14 | 10 | 4 | 6 | 8 | ||||
| Age (year) | 1.819 | 0.177 | 0.006 | 0.936 | |||||
| <60 | 23 | 18 | 5 | 4 | 19 | ||||
| ≥60 | 17 | 9 | 8 | 4 | 13 | ||||
| Tumor size(l/cm) | 0.459 | 0.498 | 0.001 | 0.974 | |||||
| <5 | 12 | 7 | 5 | 6 | 6 | ||||
| ≥5 | 28 | 21 | 7 | 9 | 12 | ||||
| Degree of differentiation | 6.567 | 0.038 | 0.688 | 0.709 | |||||
| Low differentiation | 11 | 11 | 0 | 4 | 7 | ||||
| Moderate differentiation | 16 | 14 | 2 | 5 | 11 | ||||
| High differentiation | 13 | 8 | 5 | 6 | 7 | ||||
| Lymph node metastasis | 5.260 | 0.022 | 3.472 | 0.062 | |||||
| Yes | 24 | 23 | 1 | 3 | 21 | ||||
| No | 16 | 10 | 6 | 7 | 9 | ||||
| TNM stage | 1.284 | 0.257 | 4.167 | 0.041 | |||||
| Ⅰ-Ⅱ | 15 | 8 | 7 | 6 | 9 | ||||
| Ⅲ-Ⅳ | 25 | 19 | 6 | 2 | 23 | ||||
| 1 | BATTAGLIN F, NASEEM M, LENZ H J, et al. Microsatellite instability in colorectal cancer: overview of its clinical significance and novel perspectives [J]. Clin Adv Hematol Oncol, 2018, 16(11):735-745. |
| 2 | MÁRMOL I, SÁNCHEZ-DE-DIEGO C, PRADILLA DIESTE A, et al. Colorectal carcinoma: A general overview and future perspectives in colorectal cancer [J]. Int J Mol Sci, 2017, 18(1): 197. |
| 3 | DURAN-SANCHON S, MORENO L, AUGÉ J M, et al. Identification and validation of microRNA profiles in fecal samples for detection of colorectal cancer[J]. Gastroenterology, 2020, 158(4):947-957.e4. |
| 4 | WAN Y, CUI R, GU J, et al. Identification of four oxidative stress-responsive microRNAs, miR-34a-5p, miR-1915-3p, miR-638, and miR-150-3p, in hepatocellular Carcinoma [J]. Oxidative Med Cell Longev, 2017, 2017:1-12. |
| 5 |
CUI H W, HAN W Y, HOU L N, et al. miR-1915-3p inhibits Bcl-2 expression in the development of gastric cancer [J]. Biosci Rep,2019.DOI:10.1042/bsr20182321.
doi: 10.1042/bsr20182321 |
| 6 | KHODAPASAND E, JAFARZADEH N, FARROKHI F, et al. Is Bax/Bcl-2 ratio considered as a prognostic marker with age and tumor location in colorectal cancer? [J]. Iran Biomed J, 2015, 19(2):69-75. |
| 7 | JUNG G, Hernández-Illán E, MOREIRA L, et al. Epigenetics of colorectal cancer: biomarker and therapeutic potential[J]. Nat Rev Gastroenterol Hepatol, 2020, 17(2):111-130. |
| 8 | WEN J, HALL B, SHI X. A network view of microRNA and gene interactions in different pathological stages of colon cancer [J]. BMC Med Genomics, 2019, 12(S7):158. |
| 9 | SU J,LI J,YU Q,et al. Exosomal miRNAs as potential biomarkers for acute myocardial infarction[J]. IUBMB Life, 2020, 72(3):384-400. |
| 10 | GUO J, LIU C, WANG W, et al. Identification of serum miR-1915-3p and miR-455-3p as biomarkers for breast cancer [J]. PLoS One, 2018, 13(7):e0200716. |
| 11 | GAO J, GAO L, LI R X, et al. Integrated analysis of microRNA-mRNA expression in A549 cells infected with influenza A viruses (IAVs) from different host species[J]. Virus Res, 2018, 263:34-46. |
| 12 | NAKAZAWA K, DASHZEVEG N, YOSHIDA K. Tumor suppressor p53 induces miR-1915 processing to inhibit Bcl-2 in the apoptotic response to DNA damage [J]. FEBS J, 2014, 281(13): 2937-2944. |
| 13 | SALLUSTIO F, SERINO G, COSTANTINO V, et al.miR-1915 and miR-1225-5p regulate the expression of CD133, PAX2 and TLR2 in adult renal progenitor cells[J]. PLoS One, 2013, 8(7):e68296. |
| 14 | ROOSWINKEL R W, DE KOOIJ BVAN, DE VRIES E, et al. Antiapoptotic potency of Bcl-2 proteins primarily relies on their stability, not binding selectivity [J]. Blood, 2014, 123(18): 2806-2815. |
| 15 | KLASA R J, GILLUM A M, KLEM R E, et al. Oblimersen Bcl-2 antisense: facilitating apoptosis in anticancer treatment [J]. Antisense Nucleic Acid Drug Dev, 2002, 12(3):193-213. |
| 16 | RYAN C E, DAVIDS M S. BCL-2 inhibitors, present and future [J]. Cancer J, 2019, 25(6):401-409. |
| 17 | BADR E A,ASSAR M F,ELTORGOMAN A M A, et al. A correlation between BCL-2 modifying factor, p53 and livin gene expressions in colon cancer patients[J]. Biochem Biophys Rep, 2020, 22:100747. |
| 18 | MELINCOVICI C S,MIHU C M, MĂRGINEAN M, et al. The prognostic significance of p53, Bax, Bcl-2 and cyclin E protein overexpression in colon cancer-an immunohistochemical study using the tissue microarray technique[J]. Rom J Morphol Embryol, 2016, 57(1):81-89. |
| 19 | HUANG C C, WU D W, LIN P L, et al. Paxillin promotes colorectal tumor invasion and poor patient outcomes via ERK-mediated stabilization of Bcl-2 protein by phosphorylation at Serine 87[J]. Oncotarget, 2015, 6(11):8698-8708. |
| 20 | ROSATI G, CHIACCHIO R, REGGIARDO G, et al. Thymidylate synthase expression, p53, bcl-2, Ki-67 and p27 in colorectal cancer: relationships with tumor recurrence and survival[J]. Tumor Biol, 2004, 25(5/6):258-263. |
| [1] | Bo MA,Jiangang LI,Jun WANG,Junli HOU,Liang LI. Promotion effect of miR-106b on invasion and migration of colon cancer cells through targeting TGF-β/Smad pathway [J]. Journal of Jilin University(Medicine Edition), 2021, 47(3): 630-636. |
| [2] | YAN Shengyu, XIE Yafeng, XU Zhijie, LIU Ying, DING Yating, ZHANG Qiao, LIU Wanying, LIU Libing. Inhibitory effect of antimicrobial peptide LL-37 on tumorgrowth of mice with colon cancer and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2020, 46(03): 575-581. |
| [3] | FENG Jie, REN Liqun, CHEN Suxian, WAN Yizeng, XU Peibin. Inhibitory effects of cucurbitacin B combined with oxaliplatin on proliferation and apoptosis of human colon cancer SW480 cells and their mechanisms [J]. Journal of Jilin University(Medicine Edition), 2020, 46(01): 78-83. |
| [4] | LI Hua, CAO Yansha, ZHAO Jinping, REN Fu, LI Ning. Expression of SIRT6 protein in colon cancer tissue detected by tissue microarray technique and its clinical significance [J]. Journal of Jilin University(Medicine Edition), 2019, 45(04): 893-898. |
| [5] | ZHOU Liuxiang, LIN Lin, HU Xinmin, WANG Xiaochun. Promotion effect of endocrine gland-derived vascular endothelial growth factor on proliferation and migration of colon cancer LoVo cells [J]. Journal of Jilin University Medicine Edition, 2018, 44(03): 516-520. |
| [6] | QUAN Xiaoyue, LIU Bailong, LIU Min, DONG Lihua. Treatment of lung squamous cell carcinoma with apatinib in patient who couldn't tolerate chemotherapy: A case report and literature review [J]. Journal of Jilin University Medicine Edition, 2018, 44(03): 624-627. |
| [7] | WANG Yue, LIU Chang, PIAO Xianji, ZHANG Dongyun, MENG Lingqi, WANG Hao, WANG Jiaru, LUO Yinghua, SUN Hunan, JIN Chenghao. Induction effect of tetrabromobenzotriazole on apoptosis of human colon cancer SW480 cells and its mechanism [J]. Journal of Jilin University Medicine Edition, 2017, 43(06): 1148-1154. |
| [8] | WANG Bo, SHEN Qianqian, ZHANG Hua, FENG Zhiying. Evaluation on postoperative analgesia efficacy of oxycodone combined with dexmedetomidine in patients underwent laparoscopic radical surgery of colon cancer [J]. Journal of Jilin University Medicine Edition, 2017, 43(06): 1231-1236. |
| [9] | ZHANG Chengshuai, PAN Cuiliu, GAO Yanan, HAN Bing, ZHANG Zhiru, LI Feng. Meta-analysis on influence of androgen receptor in living conditions of patients with triple-negative breast cancer [J]. Journal of Jilin University Medicine Edition, 2017, 43(01): 73-79. |
| [10] | LI Qian, LI Jingao, ZHOU Maohua, LIAO Pengjun, PENG Qi, CHEN Jing, CHEN Shaoxian, WEI Shanshan, HUANG Huiting, SHE Miaorong. Relationship between CD56 antigen expression in leukemia cells and prognosis of patients with acute myeloid leukemia [J]. Journal of Jilin University Medicine Edition, 2016, 42(02): 283-289. |
| [11] | JIANG Enping, LI He, YU Chunyan, ZHU Wei. Influence of schisandrin B in apoptosis and invasion of SW480 cells via p38MAPK signaling pathway [J]. Journal of Jilin University Medicine Edition, 2015, 41(04): 675-679. |
| [12] | ZHANG Chengcai, SONG Yanyan, ZHOU Mengjiao, CUI Zhiqian, ZHANG Xichen, XING Shenyang. Effect of RNA interference of YWHAZ gene on proliferation of colon cancer HCT-8 cells [J]. Journal of Jilin University Medicine Edition, 2015, 41(02): 307-310. |
| [13] | LIU Xiaokang, HAN Xinye, LIN Yingjia, HU Fangzhou, LI Yang, LI Qing. Influence of betulin in proliferation and apoptosis of human colon cancer SW480 cells [J]. Journal of Jilin University Medicine Edition, 2015, 41(01): 39-43. |
| [14] | ZHANG Xia,ZHANG Xiu-mei,XIAO Jian-ying. Inhibitory effect of siRNA targeting CK2α gene on growth of HCT116 cells and its mechanism [J]. Journal of Jilin University Medicine Edition, 2014, 40(03): 621-625. |
| [15] | ZHANG Hui,SHAO Guo-guang,YAN Xu,SUN Hong-wei,WANG Xing-xing,SHAO Ming-xin,MA Ke-wei . Influence of visceral pleural invasion on prognosis of patients with early non-small cell lung cancer after operation [J]. Journal of Jilin University Medicine Edition, 2014, 40(02): 369-373. |
