Journal of Jilin University(Medicine Edition) ›› 2026, Vol. 52 ›› Issue (2): 330-339.doi: 10.13481/j.1671-587X.20260204
• Research in basic medicine • Previous Articles Next Articles
Shu LI1,2,Jiaqi GUO3,Wansong LI4,Yanfeng ZHEN2,Hongjia ZHAI4,Jie LI4,Hui FANG2(
)
Received:2025-05-14
Accepted:2025-07-06
Online:2026-03-28
Published:2026-04-15
Contact:
Hui FANG
E-mail:fanghui2818@126.com
CLC Number:
Shu LI,Jiaqi GUO,Wansong LI,Yanfeng ZHEN,Hongjia ZHAI,Jie LI,Hui FANG. Improvement effect of fingolimod on hepatic fibrosis in type 2 diabetes mellitus mice and its mechanism[J].Journal of Jilin University(Medicine Edition), 2026, 52(2): 330-339.
Tab. 1
Primer sequences of RT-qPCR"
| Gene | Forward sequence(5'-3') | Reverse sequence(5'-3') |
|---|---|---|
| β-actin | GTGACGTTGACATCCGTAAAGA | GCCGGACTCATCGTACTCC |
| JAK1 | AGTGCAGTATCTCTCCTCTCTG | GATTCGGTTCGGAGCGTACC |
| JAK2 | GGAATGGCCTGCCTTACAATG | TGGCTCTATCTGCTTCACACAAT |
| STAT1 | TCACAGTGGTTCGAGCTTCAG | CGAGACATCATAGGCAGCGTG |
| STAT3 | CACTTGGATTGAGAGTCAAGAC | AGGAATCGGCTATATTGCTGGT |
| IFN-γ | GCCACGGCACAGTCATTGA | TGCTGATGGCCTGATTGTCTT |
| IL-6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
| α-SMA | TCGGATACTTCAGCGTCA | GGGAGTAATGGTTGGAATG |
Tab.4
Activities of ALT and AST, and levels of TC, TG, LDL-C, and HDL-C in serum of mice in various groups"
| Group | ALT[λB/(U·L-1)] | AST[λB/(U·L-1)] | TC[cB/(mmol·L-1)] | TG[cB/(mmol·L-1)] | LDL-C[cB/(mmol·L-1)] | HDL-C[cB/(mmol·L-1)] |
|---|---|---|---|---|---|---|
| Control | 24.74±1.933 | 29.89±2.581 | 1.51±0.100 | 0.65±0.061 | 0.40±0.036 | 1.41±0.031 |
| Control+fingolimod | 23.63±2.276 | 30.24±2.839 | 1.54±0.136 | 0.53±0.067 | 0.40±0.044 | 1.40±0.062 |
| Model | 74.13±8.297* | 90.55±6.269* | 2.45±0.133* | 2.10±0.188* | 1.28±0.074* | 0.71±0.053* |
| Model+fingolimod | 36.73±4.480△ | 44.37±3.360△ | 2.02±0.0540△ | 1.20±0.119△ | 0.71±0.049△ | 1.02±0.093△ |
Tab.5
Expression levels of JAK1, JAK2, STAT1, STAT3, IFN-γ, IL-6, and α-SMA mRNA in liver tissue of mice in various groups"
| Group | JAK1 | JAK2 | STAT1 | STAT3 | IFN-γ | IL-6 | α-SMA |
|---|---|---|---|---|---|---|---|
| Control | 1.00±0.08 | 1.00±0.15 | 1.00±0.06 | 1.00±0.10 | 1.00±0.08 | 1.00±0.13 | 1.02±0.23 |
| Control+fingolimod | 1.15±0.19 | 0.93±0.08 | 0.94±0.16 | 0.91±0.12 | 0.93±0.13 | 1.07±0.19 | 0.69±0.13 |
| Model | 5.39±0.76* | 6.01±0.48* | 0.15±0.03* | 3.92±0.22* | 0.03±0.01* | 2.99±0.15* | 8.15±0.28* |
| Model+fingolimod | 2.78±0.49△ | 3.00±0.49△ | 0.48±0.06△ | 2.84±0.20△ | 0.27±0.03△ | 1.56±0.11△ | 2.45±0.42△ |
| [1] | YAMAMURA S, ESLAM M, KAWAGUCHI T, et al. MAFLD identifies patients with significant hepatic fibrosis better than NAFLD[J]. Liver Int, 2020, 40(12): 3018-3030. |
| [2] | ZHAO J, LIU L, CAO Y Y, et al. MAFLD as part of systemic metabolic dysregulation[J]. Hepatol Int, 2024, 18(): 834-847. |
| [3] | WANG Q X, LU T M, SONG P, et al. Glycyrrhizic acid ameliorates hepatic fibrosis by inhibiting oxidative stress via AKR7A2[J]. Phytomedicine, 2024, 133: 155878. |
| [4] | CHEN J Z, GE J M, CHEN W S, et al. UPLC-Q-TOF-MS based investigation into the bioactive compounds and molecular mechanisms of Lamiophlomis Herba against hepatic fibrosis[J]. Phytomedicine, 2023, 121: 155085. |
| [5] | GUO M M, WANG Z D, DAI J Y, et al. Glycyrrhizic acid alleviates liver fibrosis in vitro and in vivo via activating CUGBP1-mediated IFN-γ/STAT1/Smad7 pathway[J]. Phytomedicine, 2023, 112: 154587. |
| [6] | HIGASHI T, FRIEDMAN S L, HOSHIDA Y. Hepatic stellate cells as key target in liver fibrosis[J]. Adv Drug Deliv Rev, 2017, 121: 27-42. |
| [7] | 韩 超, 王丽娟, 王鹏源, 等. IL-6/JAK/STAT3信号通路在纤维化疾病中作用的研究进展[J]. 中国病理生理杂志, 2022, 38(12): 2285-2290. |
| [8] | WANG Z F, KAWABORI M, HOUKIN K. FTY720 (fingolimod) ameliorates brain injury through multiple mechanisms and is a strong candidate for stroke treatment[J]. Curr Med Chem, 2020, 27(18): 2979-2993. |
| [9] | ROHRBACH T D, ASGHARPOUR A, MACZIS M A, et al. FTY720/fingolimod decreases hepatic steatosis and expression of fatty acid synthase in diet-induced nonalcoholic fatty liver disease in mice[J]. J Lipid Res, 2019, 60(7): 1311-1322. |
| [10] | YE H J, SUN M Y, JIN Z J, et al. FTY-720 alleviates diabetes-induced liver injury by inhibiting oxidative stress and inflammation[J]. Fundam Clin Pharmacol, 2023, 37(5): 960-970. |
| [11] | LOU D, FANG Q, HE Y H, et al. Oxymatrine alleviates high-fat diet/streptozotocin-induced non-alcoholic fatty liver disease in C57BL/6 J mice by modulating oxidative stress, inflammation and fibrosis[J]. Biomed Pharmacother, 2024, 174: 116491. |
| [12] | SOOD A, FERNANDES V, PREETI K, et al. Sphingosine 1 phosphate lyase inhibition rescues cognition in diabetic mice by promoting anti-inflammatory microglia[J]. Behav Brain Res, 2023, 446: 114415. |
| [13] | SOOD A, FERNANDES V, PREETI K, et al. Fingolimod alleviates cognitive deficit in type 2 diabetes by promoting microglial M2 polarization via the pSTAT3-jmjd3 axis[J]. Mol Neurobiol, 2023, 60(2): 901-922. |
| [14] | YIN Z Y, FAN L N, WEI L P, et al. FTY720 protects cardiac microvessels of diabetes: a critical role of S1P1/3 in diabetic heart disease[J]. PLoS One, 2012, 7(8): e42900. |
| [15] | LIU Z L, XU B G, DING Y P, et al. Guizhi Fuling pill attenuates liver fibrosis in vitro and in vivo via inhibiting TGF-β1/Smad2/3 and activating IFN-γ/Smad7 signaling pathways[J]. Bioengineered, 2022, 13(4): 9357-9368. |
| [16] | WENG H L, MERTENS P R, GRESSNER A M, et al. IFN-gamma abrogates profibrogenic TGF-beta signaling in liver by targeting expression of inhibitory and receptor Smads[J]. J Hepatol, 2007, 46(2): 295-303. |
| [17] | ZAI W J, CHEN W, LUAN J Y, et al. Dihydroquercetin ameliorated acetaminophen-induced hepatic cytotoxicity via activating JAK2/STAT3 pathway and autophagy[J]. Appl Microbiol Biotechnol, 2018, 102(3): 1443-1453. |
| [18] | YU H, LEE H, HERRMANN A, et al. Revisiting STAT3 signalling in cancer: new and unexpected biological functions[J]. Nat Rev Cancer, 2014, 14(11): 736-746. |
| [19] | GARRIS C S, WU L F, ACHARYA S, et al. Defective sphingosine 1-phosphate receptor 1 (S1P1) phosphorylation exacerbates TH17-mediated autoimmune neuroinflammation[J]. Nat Immunol, 2013, 14(11): 1166-1172. |
| [20] | LIU Y, DENG J H, WANG L, et al. S1PR1 is an effective target to block STAT3 signaling in activated B cell-like diffuse large B-cell lymphoma[J]. Blood, 2012, 120(7): 1458-1465. |
| [21] | GU Y J, SUN W Y, ZHANG S, et al. Targeted blockade of JAK/STAT3 signaling inhibits proliferation, migration and collagen production as well as inducing the apoptosis of hepatic stellate cells[J]. Int J Mol Med, 2016, 38(3): 903-911. |
| [22] | ZHAO J J, JIAO Y, SONG Y P, et al. Stanniocalcin 2 ameliorates hepatosteatosis through activation of STAT3 signaling[J]. Front Physiol, 2018, 9: 873. |
| [1] | Xiaoqian TANG,Shengcong WEN,Zhenya DONG,Jingyi CHEN,Yu CAO,Yunhua ZHANG. Improvement effect of engineered exosomes delivering ANGPTL6 mRNA on liver fibrosis in mice [J]. Journal of Jilin University(Medicine Edition), 2025, 51(6): 1452-1463. |
| [2] | Huixian XU,Hui XU,Jishu QUAN,Feng ZHENG. Inhibitory effect of iridoid glycosides from Boschniakia rossica on hepatic preneolasia of rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2025, 51(4): 887-895. |
| [3] | Yanbin ZHANG,Guangye GUO,Caihua ZHENG,Xinyan LIU. Research progress in association between Helicobacter pylori and metabolic syndrome and its effect on occurrence and development of metabolic syndrome [J]. Journal of Jilin University(Medicine Edition), 2024, 50(6): 1757-1762. |
| [4] | Yajie GE,Wen XU,Shimin GUAN,Lina WANG. Research progress in etiology and pathogenesis of polycystic ovary syndrome [J]. Journal of Jilin University(Medicine Edition), 2024, 50(1): 288-294. |
| [5] | Jiaxin WANG,Zhenqi WANG,Xuan ZHANG. Expressions of CDKAL1 gene and its splice isomers in peripheral blood lymphocytes of patients with type 2 diabetes mellitus and their clinical significances [J]. Journal of Jilin University(Medicine Edition), 2023, 49(5): 1290-1295. |
| [6] | Jing GUAN,Shen HA,Hao YUAN,Ying CHEN,Pengju LIU,Zhi LIU,Shuang JIANG. Protective effect of Modified Xiao-Xian-Xiong Decoction on liver injury in rats with type 2 diabete mellitus and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 608-616. |
| [7] | Xiaowei HUANG,Siqi ZHANG,Yixin ZHANG,Bo LIU,Xin WANG,Fenglan JI,Runze YANG,Huibo XU,Tao DING. Relationship between syndrome manifestations and differentially expressed genes in rat model of type 2 diabetes mellitus with Qi and Yin deficiency explored through transcriptomics [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 625-633. |
| [8] | Lingyao XU,Shutang WEI,Yong DONG,Zhenglu SUN,Junbo ZHAO,Dazheng HAN. Regulatory effect of lncRNA MALAT1 on activation of hepatic stellate cell and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(3): 697-705. |
| [9] | Junxiong ZHAO,Qian WU,Liangui NIE,Shengquan LIU,Zhentao JIANG,Jian CHEN,Ting XIAO,Jun YANG. Ameliorative effect of SO2 on myocardial fibrosis in type 2 diabetes mellitus rats and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2023, 49(1): 8-14. |
| [10] | Yihua LI,Tao WEN,Yongri QIAN,Chunshan ZHAO. Correlation analysis on relationships between levels of serum uric acid and γ-glutamyl transpeptidase and metabolic syndrome in healthy physical examination population [J]. Journal of Jilin University(Medicine Edition), 2022, 48(6): 1605-1613. |
| [11] | Mingliu GU,Fengyuan LIN,Xuefeng WU,Jianing ZHOU,Xuechun LU,Peige DU,Liping AN. Improvement effect of Phellinus igniarius acidic polysaccharide on liver fibrosis induced by bile duct ligation in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2022, 48(5): 1167-1174. |
| [12] | Yongxin ZHAI,Huaifeng TA,Yi ZHANG,Qijia SUN,Ming ZHANG,Shuqiang FENG,Ranwei LI. Effect of preoperative glycemic level on infection-related complications of diabetic patients after flexible ureteroscopic lithotripsy [J]. Journal of Jilin University(Medicine Edition), 2022, 48(3): 766-772. |
| [13] | Yang ZHENG,Jiahui WANG,Yue PENG,Xianling YUAN,Lei WANG,Tiejian ZHAO. Influence of curcumol in structure of liver sinusoidal endothelial cells of mice and its inhibitiory effect on intrahepatic angiogenesis [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1124-1130. |
| [14] | Zhouguang WU,Bin WANG,Zhen CHENG,Wenjie ZHANG,Taoyan ZUO,Siqi CHEN,Jingru FU. Analysis on correlation of GPC3 and α-SMA expressions with liver function-related indexes in liver tissue of children with biliary atresia [J]. Journal of Jilin University(Medicine Edition), 2021, 47(5): 1237-1243. |
| [15] | Rongjun JIA,Liman MA,Lihua LI. Protective effect of calcitriol on hepatic fibrosis induced by bile duct ligation in mice and its mechanism [J]. Journal of Jilin University(Medicine Edition), 2021, 47(2): 257-264. |
|